Multiple sequence alignment - TraesCS1D01G258300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G258300 chr1D 100.000 2297 0 0 1 2297 350976829 350979125 0.000000e+00 4242
1 TraesCS1D01G258300 chr6D 98.303 2298 38 1 1 2297 430467625 430465328 0.000000e+00 4026
2 TraesCS1D01G258300 chr6D 97.372 1941 47 2 137 2077 370001600 369999664 0.000000e+00 3299
3 TraesCS1D01G258300 chr6D 93.627 1930 97 9 281 2207 183386761 183384855 0.000000e+00 2859
4 TraesCS1D01G258300 chr3D 97.616 2307 45 2 1 2297 202626331 202624025 0.000000e+00 3947
5 TraesCS1D01G258300 chr3D 96.667 1710 56 1 588 2297 498443578 498445286 0.000000e+00 2841
6 TraesCS1D01G258300 chr4D 97.431 2297 58 1 1 2297 97360978 97363273 0.000000e+00 3914
7 TraesCS1D01G258300 chr4D 95.650 2299 96 1 3 2297 241247493 241249791 0.000000e+00 3688
8 TraesCS1D01G258300 chr4D 95.432 2255 83 6 1 2254 241310192 241312427 0.000000e+00 3576
9 TraesCS1D01G258300 chr4D 96.758 802 21 1 1 802 135047392 135048188 0.000000e+00 1332
10 TraesCS1D01G258300 chr5D 96.340 2295 72 3 3 2297 80104918 80102636 0.000000e+00 3762
11 TraesCS1D01G258300 chrUn 97.829 1428 21 2 1 1418 275334265 275335692 0.000000e+00 2457
12 TraesCS1D01G258300 chr4A 95.299 1170 50 1 1 1170 295191742 295190578 0.000000e+00 1851
13 TraesCS1D01G258300 chr4A 95.006 841 41 1 1 841 350192177 350191338 0.000000e+00 1319
14 TraesCS1D01G258300 chr5A 96.667 90 3 0 2208 2297 55022084 55022173 1.420000e-32 150
15 TraesCS1D01G258300 chr6B 97.674 86 2 0 2212 2297 621321410 621321325 5.110000e-32 148
16 TraesCS1D01G258300 chr5B 94.667 75 3 1 2213 2287 227838625 227838552 5.190000e-22 115


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G258300 chr1D 350976829 350979125 2296 False 4242 4242 100.000 1 2297 1 chr1D.!!$F1 2296
1 TraesCS1D01G258300 chr6D 430465328 430467625 2297 True 4026 4026 98.303 1 2297 1 chr6D.!!$R3 2296
2 TraesCS1D01G258300 chr6D 369999664 370001600 1936 True 3299 3299 97.372 137 2077 1 chr6D.!!$R2 1940
3 TraesCS1D01G258300 chr6D 183384855 183386761 1906 True 2859 2859 93.627 281 2207 1 chr6D.!!$R1 1926
4 TraesCS1D01G258300 chr3D 202624025 202626331 2306 True 3947 3947 97.616 1 2297 1 chr3D.!!$R1 2296
5 TraesCS1D01G258300 chr3D 498443578 498445286 1708 False 2841 2841 96.667 588 2297 1 chr3D.!!$F1 1709
6 TraesCS1D01G258300 chr4D 97360978 97363273 2295 False 3914 3914 97.431 1 2297 1 chr4D.!!$F1 2296
7 TraesCS1D01G258300 chr4D 241247493 241249791 2298 False 3688 3688 95.650 3 2297 1 chr4D.!!$F3 2294
8 TraesCS1D01G258300 chr4D 241310192 241312427 2235 False 3576 3576 95.432 1 2254 1 chr4D.!!$F4 2253
9 TraesCS1D01G258300 chr4D 135047392 135048188 796 False 1332 1332 96.758 1 802 1 chr4D.!!$F2 801
10 TraesCS1D01G258300 chr5D 80102636 80104918 2282 True 3762 3762 96.340 3 2297 1 chr5D.!!$R1 2294
11 TraesCS1D01G258300 chrUn 275334265 275335692 1427 False 2457 2457 97.829 1 1418 1 chrUn.!!$F1 1417
12 TraesCS1D01G258300 chr4A 295190578 295191742 1164 True 1851 1851 95.299 1 1170 1 chr4A.!!$R1 1169
13 TraesCS1D01G258300 chr4A 350191338 350192177 839 True 1319 1319 95.006 1 841 1 chr4A.!!$R2 840

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
688 736 1.483415 TGGCCTTACGTTCAGGATACC 59.517 52.381 15.92 8.96 32.41 2.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2142 2194 2.044946 GGGATCGCTTGCCAACCT 60.045 61.111 1.84 0.0 35.48 3.5 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
174 175 4.357918 AGGAGCGCCATATGTTTCTATT 57.642 40.909 9.88 0.00 36.29 1.73
439 442 5.550403 AGAATTGACCCCTGAACTACCTTTA 59.450 40.000 0.00 0.00 0.00 1.85
688 736 1.483415 TGGCCTTACGTTCAGGATACC 59.517 52.381 15.92 8.96 32.41 2.73
711 760 4.215399 CCCTTTCTGTCTTTGCGATGTTTA 59.785 41.667 0.00 0.00 0.00 2.01
743 792 4.816385 AGAATGTTGCTCTTCAGAAAACGA 59.184 37.500 0.00 0.00 0.00 3.85
932 981 6.348540 GCTGAAAAAGATGGACAGTAACGATT 60.349 38.462 0.00 0.00 0.00 3.34
1021 1070 0.034089 GGGGGACTTTGATGGTGAGG 60.034 60.000 0.00 0.00 0.00 3.86
1069 1118 1.935873 ACTTTCGCATGATCGATGGTG 59.064 47.619 0.54 2.10 38.37 4.17
1195 1244 3.758300 CCAATATGCGAAGTGGTCAAAC 58.242 45.455 0.00 0.00 0.00 2.93
1207 1256 1.899814 TGGTCAAACTAGGAGTCGCAT 59.100 47.619 0.00 0.00 0.00 4.73
1308 1357 7.519008 GCAGCTTTCAAATGACGTATAAGCTAT 60.519 37.037 15.25 0.00 39.70 2.97
1419 1469 0.036388 GACTGGCTTCCACCAATCGA 60.036 55.000 0.00 0.00 39.86 3.59
1426 1476 2.552315 GCTTCCACCAATCGAAGTTTCA 59.448 45.455 0.00 0.00 38.20 2.69
1605 1656 0.620556 GAGGAATCCACAAGAGGCCA 59.379 55.000 5.01 0.00 0.00 5.36
1876 1927 1.059979 CGCGCATACGTTTTCTTGCTA 59.940 47.619 8.75 0.00 42.83 3.49
2033 2085 7.700322 TCGCTCAATACTCAAATCTACAATC 57.300 36.000 0.00 0.00 0.00 2.67
2034 2086 7.264947 TCGCTCAATACTCAAATCTACAATCA 58.735 34.615 0.00 0.00 0.00 2.57
2142 2194 5.104024 TGGGTTTTCACTGGTCCTAACTAAA 60.104 40.000 0.00 0.00 0.00 1.85
2287 2343 4.039973 AGTCTTTTGGTCCACGTCTTCATA 59.960 41.667 0.00 0.00 0.00 2.15
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
174 175 0.869730 GCCTCGCTTTACCGTTTCAA 59.130 50.000 0.00 0.0 0.00 2.69
439 442 2.943036 TTCTACAAGAAAAGGCGGGT 57.057 45.000 0.00 0.0 29.99 5.28
489 492 4.164221 CCTCATTCCACTAGCCCTAAAAGA 59.836 45.833 0.00 0.0 0.00 2.52
688 736 2.154462 ACATCGCAAAGACAGAAAGGG 58.846 47.619 0.00 0.0 0.00 3.95
743 792 2.048444 TCGACGAAGGCCACTATACT 57.952 50.000 5.01 0.0 0.00 2.12
932 981 5.242434 AGGCCGATAAATTGATATTACGCA 58.758 37.500 0.00 0.0 0.00 5.24
1195 1244 7.817641 TCATAAATAGTACATGCGACTCCTAG 58.182 38.462 4.21 0.0 0.00 3.02
1207 1256 7.684317 TCCCAGGAACATCATAAATAGTACA 57.316 36.000 0.00 0.0 0.00 2.90
1419 1469 5.475719 CACCATCTGAAATGCATGAAACTT 58.524 37.500 0.00 0.0 0.00 2.66
1426 1476 5.018809 ACTTTACCACCATCTGAAATGCAT 58.981 37.500 0.00 0.0 0.00 3.96
1533 1583 6.056236 AGGAAGGCCGATTTTCTTTCTATAC 58.944 40.000 0.00 0.0 39.96 1.47
1605 1656 5.359576 TCTTTTATGCAATTATGAACGGGCT 59.640 36.000 0.00 0.0 0.00 5.19
1876 1927 8.749354 ACACAAAAACTTTCTGAGAAATTACCT 58.251 29.630 8.23 0.0 0.00 3.08
2142 2194 2.044946 GGGATCGCTTGCCAACCT 60.045 61.111 1.84 0.0 35.48 3.50


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.