Multiple sequence alignment - TraesCS1D01G258200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G258200 chr1D 100.000 2291 0 0 1 2291 350970601 350972891 0 4231
1 TraesCS1D01G258200 chr6D 97.951 2294 44 2 1 2291 430476544 430474251 0 3973
2 TraesCS1D01G258200 chr3D 97.690 2294 49 4 1 2291 202632563 202630271 0 3940
3 TraesCS1D01G258200 chr3D 96.861 2294 67 4 1 2291 498436732 498439023 0 3832
4 TraesCS1D01G258200 chr7B 97.691 2295 45 5 1 2291 742929145 742931435 0 3938
5 TraesCS1D01G258200 chr7A 97.647 2295 46 5 1 2291 200015314 200013024 0 3932
6 TraesCS1D01G258200 chrUn 97.605 2296 46 5 1 2291 246705336 246703045 0 3927
7 TraesCS1D01G258200 chr6A 96.904 2293 65 3 1 2291 597220367 597222655 0 3836


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G258200 chr1D 350970601 350972891 2290 False 4231 4231 100.000 1 2291 1 chr1D.!!$F1 2290
1 TraesCS1D01G258200 chr6D 430474251 430476544 2293 True 3973 3973 97.951 1 2291 1 chr6D.!!$R1 2290
2 TraesCS1D01G258200 chr3D 202630271 202632563 2292 True 3940 3940 97.690 1 2291 1 chr3D.!!$R1 2290
3 TraesCS1D01G258200 chr3D 498436732 498439023 2291 False 3832 3832 96.861 1 2291 1 chr3D.!!$F1 2290
4 TraesCS1D01G258200 chr7B 742929145 742931435 2290 False 3938 3938 97.691 1 2291 1 chr7B.!!$F1 2290
5 TraesCS1D01G258200 chr7A 200013024 200015314 2290 True 3932 3932 97.647 1 2291 1 chr7A.!!$R1 2290
6 TraesCS1D01G258200 chrUn 246703045 246705336 2291 True 3927 3927 97.605 1 2291 1 chrUn.!!$R1 2290
7 TraesCS1D01G258200 chr6A 597220367 597222655 2288 False 3836 3836 96.904 1 2291 1 chr6A.!!$F1 2290

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
445 446 1.224003 AATCCATGCTTCCCCCACCT 61.224 55.0 0.0 0.0 0.0 4.0 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1346 1349 0.966179 GCCCGACTTTCCCAAATGTT 59.034 50.0 0.0 0.0 0.0 2.71 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
210 211 8.428063 CACTTTGAGGGATATAGATGAAGTCTT 58.572 37.037 0.00 0.00 38.42 3.01
236 237 7.039714 TGCTCAGTAAAGAGAGTTGTAGATTCA 60.040 37.037 0.00 0.00 37.87 2.57
245 246 9.693739 AAGAGAGTTGTAGATTCATAGAAGAGA 57.306 33.333 0.00 0.00 0.00 3.10
294 295 3.691609 AGCTAGCCAATGAAAGTAAGTGC 59.308 43.478 12.13 0.00 0.00 4.40
348 349 2.840102 CCCCCGGTTGTTTTGGCA 60.840 61.111 0.00 0.00 0.00 4.92
442 443 1.227102 CGAATCCATGCTTCCCCCA 59.773 57.895 0.00 0.00 0.00 4.96
445 446 1.224003 AATCCATGCTTCCCCCACCT 61.224 55.000 0.00 0.00 0.00 4.00
754 756 1.541310 CCTAGTGGACTTGGCGGTGA 61.541 60.000 0.00 0.00 32.52 4.02
778 780 5.261216 TCCTTTCTCAAACCAGAACAACTT 58.739 37.500 0.00 0.00 31.88 2.66
859 861 1.442520 CCGAACCGAACGTTAGCGA 60.443 57.895 5.81 0.00 42.00 4.93
903 905 2.679934 CGTTGCTGCTTGATCGGCA 61.680 57.895 11.69 11.69 45.73 5.69
1061 1063 0.745845 GTCTGCGCTGGTGAATGGAT 60.746 55.000 14.70 0.00 0.00 3.41
1233 1236 7.164122 TCGTCTCGGTAGGTGTATTATTCTAT 58.836 38.462 0.00 0.00 0.00 1.98
1284 1287 3.087253 TTCCCGGGCGATCACCAT 61.087 61.111 18.49 0.00 0.00 3.55
1344 1347 1.360393 ACAGGAAAAGGGCTGGTGGA 61.360 55.000 0.00 0.00 0.00 4.02
1346 1349 1.152830 GGAAAAGGGCTGGTGGACA 59.847 57.895 0.00 0.00 0.00 4.02
1417 1420 3.067742 ACAGAGGAAGAACGAAACGAAGA 59.932 43.478 0.00 0.00 0.00 2.87
1581 1584 1.073897 GTGAGCAGGGCCTTCAAGT 59.926 57.895 1.32 0.00 0.00 3.16
1622 1625 6.095021 GGGTTGTAAATGACATACCTTTCCTC 59.905 42.308 4.68 0.00 38.38 3.71
1732 1735 0.989602 CTAAAAAGGACCCTCCCCGT 59.010 55.000 0.00 0.00 37.19 5.28
1832 1835 2.749621 AGTTCTCAATCATTTCGTGGCC 59.250 45.455 0.00 0.00 0.00 5.36
1833 1836 1.368641 TCTCAATCATTTCGTGGCCG 58.631 50.000 0.00 0.00 0.00 6.13
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
98 99 3.541632 TCGGTTTGAATCAAGATAGGGC 58.458 45.455 0.00 0.0 0.00 5.19
210 211 6.842437 ATCTACAACTCTCTTTACTGAGCA 57.158 37.500 0.00 0.0 34.29 4.26
236 237 4.319911 GCGCGTACTCTGATTCTCTTCTAT 60.320 45.833 8.43 0.0 0.00 1.98
245 246 0.591741 GTAGCGCGCGTACTCTGATT 60.592 55.000 32.35 6.4 0.00 2.57
348 349 1.891722 CTAACGTTGGGGTAGGGCGT 61.892 60.000 11.99 0.0 37.38 5.68
445 446 2.158943 TCTGGATAGAGTCTCGCTTCGA 60.159 50.000 0.00 0.0 0.00 3.71
519 520 6.925165 CAGGCAGTTGTCATTTTCAAGTAAAT 59.075 34.615 0.00 0.0 0.00 1.40
754 756 5.449553 AGTTGTTCTGGTTTGAGAAAGGAT 58.550 37.500 0.00 0.0 33.73 3.24
778 780 5.878627 TCCCTTATTTTCCCTAACGTTCAA 58.121 37.500 2.82 0.0 0.00 2.69
859 861 4.500035 GCTCGTGATAGGCTTAGCTTAAGT 60.500 45.833 3.59 0.0 38.07 2.24
903 905 4.657969 CCATACTTTGAGATCTTCCTCCCT 59.342 45.833 0.00 0.0 32.32 4.20
1061 1063 3.230245 CTTTTTGTGGCGGGGGCA 61.230 61.111 0.00 0.0 35.21 5.36
1344 1347 1.960689 CCCGACTTTCCCAAATGTTGT 59.039 47.619 0.00 0.0 0.00 3.32
1346 1349 0.966179 GCCCGACTTTCCCAAATGTT 59.034 50.000 0.00 0.0 0.00 2.71
1561 1564 2.134630 CTTGAAGGCCCTGCTCACCT 62.135 60.000 0.00 0.0 34.45 4.00
1622 1625 2.492773 GGAGGCGGCATTTCCCATG 61.493 63.158 13.08 0.0 0.00 3.66
1732 1735 2.424842 ATTCAAGGAGGGGCGCACAA 62.425 55.000 13.89 0.0 0.00 3.33
1832 1835 2.978010 GGTTCAGCCACACCCACG 60.978 66.667 0.00 0.0 37.17 4.94
1833 1836 2.194597 TGGTTCAGCCACACCCAC 59.805 61.111 0.00 0.0 43.61 4.61
2114 2121 7.231467 TCCTAAATTGAGCTAGGAGTTGTTTT 58.769 34.615 0.00 0.0 39.02 2.43


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.