Multiple sequence alignment - TraesCS1D01G246800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G246800 chr1D 100.000 3125 0 0 1 3125 339308927 339312051 0.000000e+00 5771.0
1 TraesCS1D01G246800 chr1D 98.126 2721 48 2 406 3125 462971627 462974345 0.000000e+00 4739.0
2 TraesCS1D01G246800 chr1D 95.384 2708 82 25 431 3125 232137569 232134892 0.000000e+00 4268.0
3 TraesCS1D01G246800 chr1D 96.088 409 9 3 1 405 462970598 462971003 0.000000e+00 660.0
4 TraesCS1D01G246800 chr1D 95.599 409 15 3 1 408 232138525 232138119 0.000000e+00 652.0
5 TraesCS1D01G246800 chr2D 97.060 2619 65 9 516 3125 422069278 422071893 0.000000e+00 4399.0
6 TraesCS1D01G246800 chr2D 97.887 2508 51 2 619 3125 437672490 437669984 0.000000e+00 4337.0
7 TraesCS1D01G246800 chr2D 97.632 2492 55 4 636 3125 396654218 396656707 0.000000e+00 4272.0
8 TraesCS1D01G246800 chr7D 95.855 2726 88 18 411 3125 24347207 24349918 0.000000e+00 4385.0
9 TraesCS1D01G246800 chr7D 98.079 2499 45 3 630 3125 602036205 602033707 0.000000e+00 4346.0
10 TraesCS1D01G246800 chr7D 97.527 2507 56 2 619 3125 271761447 271763947 0.000000e+00 4281.0
11 TraesCS1D01G246800 chr7D 97.412 2512 56 4 619 3125 632615560 632613053 0.000000e+00 4270.0
12 TraesCS1D01G246800 chr7D 95.782 403 17 0 1 403 468269700 468270102 0.000000e+00 651.0
13 TraesCS1D01G246800 chr6B 95.806 2718 97 11 423 3125 127034720 127032005 0.000000e+00 4372.0
14 TraesCS1D01G246800 chr3B 95.705 2701 107 5 431 3125 682998234 682995537 0.000000e+00 4337.0
15 TraesCS1D01G246800 chr3B 94.853 408 18 1 1 408 682999415 682999011 4.400000e-178 634.0
16 TraesCS1D01G246800 chr3B 93.873 408 22 1 1 408 682994940 682994536 2.060000e-171 612.0
17 TraesCS1D01G246800 chr1B 95.133 2712 113 11 423 3125 52051302 52054003 0.000000e+00 4259.0
18 TraesCS1D01G246800 chr1B 94.363 408 18 3 1 408 52050288 52050690 3.420000e-174 621.0
19 TraesCS1D01G246800 chr1B 93.154 409 20 3 1 408 538476181 538476582 7.460000e-166 593.0
20 TraesCS1D01G246800 chr7B 94.397 2695 129 16 440 3125 363251629 363254310 0.000000e+00 4120.0
21 TraesCS1D01G246800 chr2B 90.045 1999 153 20 431 2416 96032493 96034458 0.000000e+00 2547.0
22 TraesCS1D01G246800 chr5B 92.308 1248 72 17 444 1683 689649641 689650872 0.000000e+00 1751.0
23 TraesCS1D01G246800 chr4B 94.349 407 18 3 1 406 95602405 95602807 1.230000e-173 619.0
24 TraesCS1D01G246800 chr4A 89.268 410 37 6 1 408 651986776 651987180 1.000000e-139 507.0
25 TraesCS1D01G246800 chr3A 87.059 85 4 2 422 506 609945265 609945188 4.290000e-14 89.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G246800 chr1D 339308927 339312051 3124 False 5771.0 5771 100.000000 1 3125 1 chr1D.!!$F1 3124
1 TraesCS1D01G246800 chr1D 462970598 462974345 3747 False 2699.5 4739 97.107000 1 3125 2 chr1D.!!$F2 3124
2 TraesCS1D01G246800 chr1D 232134892 232138525 3633 True 2460.0 4268 95.491500 1 3125 2 chr1D.!!$R1 3124
3 TraesCS1D01G246800 chr2D 422069278 422071893 2615 False 4399.0 4399 97.060000 516 3125 1 chr2D.!!$F2 2609
4 TraesCS1D01G246800 chr2D 437669984 437672490 2506 True 4337.0 4337 97.887000 619 3125 1 chr2D.!!$R1 2506
5 TraesCS1D01G246800 chr2D 396654218 396656707 2489 False 4272.0 4272 97.632000 636 3125 1 chr2D.!!$F1 2489
6 TraesCS1D01G246800 chr7D 24347207 24349918 2711 False 4385.0 4385 95.855000 411 3125 1 chr7D.!!$F1 2714
7 TraesCS1D01G246800 chr7D 602033707 602036205 2498 True 4346.0 4346 98.079000 630 3125 1 chr7D.!!$R1 2495
8 TraesCS1D01G246800 chr7D 271761447 271763947 2500 False 4281.0 4281 97.527000 619 3125 1 chr7D.!!$F2 2506
9 TraesCS1D01G246800 chr7D 632613053 632615560 2507 True 4270.0 4270 97.412000 619 3125 1 chr7D.!!$R2 2506
10 TraesCS1D01G246800 chr6B 127032005 127034720 2715 True 4372.0 4372 95.806000 423 3125 1 chr6B.!!$R1 2702
11 TraesCS1D01G246800 chr3B 682994536 682999415 4879 True 1861.0 4337 94.810333 1 3125 3 chr3B.!!$R1 3124
12 TraesCS1D01G246800 chr1B 52050288 52054003 3715 False 2440.0 4259 94.748000 1 3125 2 chr1B.!!$F2 3124
13 TraesCS1D01G246800 chr7B 363251629 363254310 2681 False 4120.0 4120 94.397000 440 3125 1 chr7B.!!$F1 2685
14 TraesCS1D01G246800 chr2B 96032493 96034458 1965 False 2547.0 2547 90.045000 431 2416 1 chr2B.!!$F1 1985
15 TraesCS1D01G246800 chr5B 689649641 689650872 1231 False 1751.0 1751 92.308000 444 1683 1 chr5B.!!$F1 1239

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
236 241 1.480545 TCCCGATGAACACGATGATGT 59.519 47.619 0.00 0.0 0.0 3.06 F
611 1942 3.005539 TGGACCAGGCCAGAGAGC 61.006 66.667 5.01 0.0 33.1 4.09 F
1291 2639 0.438830 GTTTGAGCGGCTGAAGTACG 59.561 55.000 7.50 0.0 0.0 3.67 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1291 2639 3.245948 CTGCACGTGGCTTCACAGC 62.246 63.158 18.88 0.0 46.52 4.40 R
1632 2980 3.261897 CCCTCTTCTTCTGTTGAGGCTTA 59.738 47.826 0.00 0.0 43.34 3.09 R
2816 4188 1.070957 GGGTGGCCTAACCTATCGC 59.929 63.158 11.83 0.0 40.35 4.58 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
59 64 4.366267 ACCTATGGTGTGGATTTCTCTCT 58.634 43.478 0.00 0.00 32.98 3.10
236 241 1.480545 TCCCGATGAACACGATGATGT 59.519 47.619 0.00 0.00 0.00 3.06
241 246 4.788100 CCGATGAACACGATGATGTTTTTC 59.212 41.667 0.00 0.00 42.89 2.29
611 1942 3.005539 TGGACCAGGCCAGAGAGC 61.006 66.667 5.01 0.00 33.10 4.09
612 1943 3.005539 GGACCAGGCCAGAGAGCA 61.006 66.667 5.01 0.00 0.00 4.26
729 2070 3.951979 ACTGTCTGTTTTCGCTGAAAG 57.048 42.857 4.41 0.00 32.93 2.62
1291 2639 0.438830 GTTTGAGCGGCTGAAGTACG 59.561 55.000 7.50 0.00 0.00 3.67
1514 2862 3.197116 CAGGGGAACTACACGAGGTATTT 59.803 47.826 0.00 0.00 0.00 1.40
1632 2980 0.387929 TGAACGCTCTCAAAGTCCGT 59.612 50.000 0.00 0.00 0.00 4.69
2158 3523 6.618287 TGGTTATCATGATTCCGTGATTTC 57.382 37.500 14.65 1.19 44.37 2.17
2245 3610 3.129287 ACTTTGGCGATTGGATGACATTC 59.871 43.478 0.00 0.00 0.00 2.67
2661 4033 1.880027 GATGAAAACGGCAAGGAGTGT 59.120 47.619 0.00 0.00 0.00 3.55
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
59 64 1.942677 TTCGTCCGCTCAGTTTTTGA 58.057 45.000 0.00 0.00 0.00 2.69
236 241 2.073816 GCGTCGGGATCTCAAGAAAAA 58.926 47.619 0.00 0.00 0.00 1.94
241 246 2.278857 CGGCGTCGGGATCTCAAG 60.279 66.667 0.00 0.00 0.00 3.02
729 2070 3.612472 TTTTTAAGCCCATATACGCGC 57.388 42.857 5.73 0.00 0.00 6.86
737 2078 2.168313 CCCGAAGCATTTTTAAGCCCAT 59.832 45.455 0.00 0.00 0.00 4.00
1291 2639 3.245948 CTGCACGTGGCTTCACAGC 62.246 63.158 18.88 0.00 46.52 4.40
1514 2862 3.427573 TGGAGGACGTCAATCAACTCTA 58.572 45.455 18.91 8.45 0.00 2.43
1632 2980 3.261897 CCCTCTTCTTCTGTTGAGGCTTA 59.738 47.826 0.00 0.00 43.34 3.09
2219 3584 4.520874 TGTCATCCAATCGCCAAAGTAAAA 59.479 37.500 0.00 0.00 0.00 1.52
2347 3717 3.458779 GCCACACGCGTTCTAAAATAA 57.541 42.857 10.22 0.00 0.00 1.40
2661 4033 2.176045 TCCCGCTTTGTGATGAGTAGA 58.824 47.619 0.00 0.00 0.00 2.59
2816 4188 1.070957 GGGTGGCCTAACCTATCGC 59.929 63.158 11.83 0.00 40.35 4.58
2938 4310 3.433740 GGCCTAATGACTAACTTCCCCTG 60.434 52.174 0.00 0.00 0.00 4.45


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.