Multiple sequence alignment - TraesCS1D01G235600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G235600 chr1D 100.000 2345 0 0 1 2345 324705788 324703444 0.000000e+00 4331.0
1 TraesCS1D01G235600 chr1D 93.632 2387 101 11 2 2345 495236147 495238525 0.000000e+00 3518.0
2 TraesCS1D01G235600 chr1D 90.179 784 47 7 1 781 253351000 253350244 0.000000e+00 994.0
3 TraesCS1D01G235600 chr1D 93.023 301 20 1 2046 2345 310855684 310855984 2.770000e-119 438.0
4 TraesCS1D01G235600 chr3D 94.402 2376 90 13 1 2345 594818780 594816417 0.000000e+00 3611.0
5 TraesCS1D01G235600 chr3D 94.397 2356 101 13 3 2342 304905254 304907594 0.000000e+00 3591.0
6 TraesCS1D01G235600 chr4D 95.124 2297 89 8 28 2319 476862250 476864528 0.000000e+00 3600.0
7 TraesCS1D01G235600 chr5D 94.746 2322 86 15 28 2345 487587398 487589687 0.000000e+00 3579.0
8 TraesCS1D01G235600 chr5D 93.779 2363 91 10 28 2345 174805245 174802894 0.000000e+00 3498.0
9 TraesCS1D01G235600 chr5D 94.864 623 20 1 1735 2345 431561179 431561801 0.000000e+00 963.0
10 TraesCS1D01G235600 chr5D 95.873 315 12 1 2032 2345 382504522 382504836 2.080000e-140 508.0
11 TraesCS1D01G235600 chr7D 93.171 2387 105 14 1 2345 586895640 586893270 0.000000e+00 3452.0
12 TraesCS1D01G235600 chr7D 95.499 1422 48 3 939 2345 110587262 110585842 0.000000e+00 2257.0
13 TraesCS1D01G235600 chr7D 94.013 451 15 1 1907 2345 562194089 562194539 0.000000e+00 673.0
14 TraesCS1D01G235600 chr7D 93.382 408 13 5 1952 2345 554899891 554899484 2.010000e-165 592.0
15 TraesCS1D01G235600 chr6D 92.413 2346 141 15 1 2318 87471370 87469034 0.000000e+00 3312.0
16 TraesCS1D01G235600 chr1A 91.991 2335 161 8 28 2345 478547502 478545177 0.000000e+00 3253.0
17 TraesCS1D01G235600 chr4A 93.498 2184 103 10 9 2162 637920752 637918578 0.000000e+00 3210.0
18 TraesCS1D01G235600 chr4A 100.000 38 0 0 1 38 697569286 697569249 1.160000e-08 71.3
19 TraesCS1D01G235600 chr2D 92.384 2009 136 10 28 2029 564074489 564076487 0.000000e+00 2846.0
20 TraesCS1D01G235600 chr3A 90.541 962 63 12 29 988 137612177 137613112 0.000000e+00 1247.0
21 TraesCS1D01G235600 chr3A 100.000 29 0 0 29 57 690751468 690751440 1.000000e-03 54.7
22 TraesCS1D01G235600 chr7B 100.000 38 0 0 1 38 36547639 36547676 1.160000e-08 71.3
23 TraesCS1D01G235600 chr7B 100.000 38 0 0 1 38 71177773 71177736 1.160000e-08 71.3
24 TraesCS1D01G235600 chr7B 100.000 38 0 0 1 38 147583961 147583924 1.160000e-08 71.3
25 TraesCS1D01G235600 chr2B 91.667 48 3 1 1 48 620211165 620211119 5.410000e-07 65.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G235600 chr1D 324703444 324705788 2344 True 4331 4331 100.000 1 2345 1 chr1D.!!$R2 2344
1 TraesCS1D01G235600 chr1D 495236147 495238525 2378 False 3518 3518 93.632 2 2345 1 chr1D.!!$F2 2343
2 TraesCS1D01G235600 chr1D 253350244 253351000 756 True 994 994 90.179 1 781 1 chr1D.!!$R1 780
3 TraesCS1D01G235600 chr3D 594816417 594818780 2363 True 3611 3611 94.402 1 2345 1 chr3D.!!$R1 2344
4 TraesCS1D01G235600 chr3D 304905254 304907594 2340 False 3591 3591 94.397 3 2342 1 chr3D.!!$F1 2339
5 TraesCS1D01G235600 chr4D 476862250 476864528 2278 False 3600 3600 95.124 28 2319 1 chr4D.!!$F1 2291
6 TraesCS1D01G235600 chr5D 487587398 487589687 2289 False 3579 3579 94.746 28 2345 1 chr5D.!!$F3 2317
7 TraesCS1D01G235600 chr5D 174802894 174805245 2351 True 3498 3498 93.779 28 2345 1 chr5D.!!$R1 2317
8 TraesCS1D01G235600 chr5D 431561179 431561801 622 False 963 963 94.864 1735 2345 1 chr5D.!!$F2 610
9 TraesCS1D01G235600 chr7D 586893270 586895640 2370 True 3452 3452 93.171 1 2345 1 chr7D.!!$R3 2344
10 TraesCS1D01G235600 chr7D 110585842 110587262 1420 True 2257 2257 95.499 939 2345 1 chr7D.!!$R1 1406
11 TraesCS1D01G235600 chr6D 87469034 87471370 2336 True 3312 3312 92.413 1 2318 1 chr6D.!!$R1 2317
12 TraesCS1D01G235600 chr1A 478545177 478547502 2325 True 3253 3253 91.991 28 2345 1 chr1A.!!$R1 2317
13 TraesCS1D01G235600 chr4A 637918578 637920752 2174 True 3210 3210 93.498 9 2162 1 chr4A.!!$R1 2153
14 TraesCS1D01G235600 chr2D 564074489 564076487 1998 False 2846 2846 92.384 28 2029 1 chr2D.!!$F1 2001
15 TraesCS1D01G235600 chr3A 137612177 137613112 935 False 1247 1247 90.541 29 988 1 chr3A.!!$F1 959

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
511 552 1.075970 AGGGAGGCGCTCTACATGA 60.076 57.895 7.64 0.0 0.00 3.07 F
1095 1159 0.603569 AAGAGGACGAGTGCGACATT 59.396 50.000 0.00 0.0 41.64 2.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1343 1414 0.035056 CCGCTTGGAAATGGAGACCT 60.035 55.0 0.0 0.0 33.02 3.85 R
2127 2209 0.669077 ACGCCATAGATCACTCGTCC 59.331 55.0 0.0 0.0 0.00 4.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
253 269 2.435586 TCGACCTCGACCTCGACC 60.436 66.667 5.73 0.00 44.22 4.79
254 270 2.436292 CGACCTCGACCTCGACCT 60.436 66.667 1.47 0.00 44.22 3.85
255 271 2.462782 CGACCTCGACCTCGACCTC 61.463 68.421 1.47 0.00 44.22 3.85
256 272 2.436292 ACCTCGACCTCGACCTCG 60.436 66.667 0.00 1.30 44.22 4.63
257 273 2.125229 CCTCGACCTCGACCTCGA 60.125 66.667 8.88 8.88 44.22 4.04
258 274 2.462782 CCTCGACCTCGACCTCGAC 61.463 68.421 5.73 0.00 44.22 4.20
446 463 3.148279 GGACGCGAGGGATGAGGT 61.148 66.667 15.93 0.00 0.00 3.85
474 515 1.598130 GCAGGAGTTCACCAACGCT 60.598 57.895 0.00 0.00 37.61 5.07
475 516 1.166531 GCAGGAGTTCACCAACGCTT 61.167 55.000 0.00 0.00 37.61 4.68
511 552 1.075970 AGGGAGGCGCTCTACATGA 60.076 57.895 7.64 0.00 0.00 3.07
694 736 3.311110 GGGAGTGCTCACCCGACA 61.311 66.667 5.49 0.00 34.97 4.35
1038 1101 2.427245 CGATCTGGACGGCTTCCCT 61.427 63.158 7.65 0.00 45.17 4.20
1095 1159 0.603569 AAGAGGACGAGTGCGACATT 59.396 50.000 0.00 0.00 41.64 2.71
1192 1263 2.258591 CGTACACAGCTGCCGAGT 59.741 61.111 15.27 10.15 0.00 4.18
1403 1474 2.093553 AGTGCAACAAGTTTTGTGCCAT 60.094 40.909 0.00 1.99 44.59 4.40
1457 1528 2.520465 ATCGGCGTGCAAGACATGGA 62.520 55.000 6.24 0.00 35.67 3.41
1571 1644 6.705825 GGAAACATTTTGTAGGCATTTCAAGT 59.294 34.615 0.00 0.00 0.00 3.16
1573 1646 7.481275 AACATTTTGTAGGCATTTCAAGTTG 57.519 32.000 0.00 0.00 0.00 3.16
1594 1667 4.728772 TGTGGAGACATTCAAGGTTCAAT 58.271 39.130 0.00 0.00 46.14 2.57
1652 1725 2.159170 GGGTCATCAAGGACGAAGAGAG 60.159 54.545 0.00 0.00 38.70 3.20
1670 1743 4.018960 AGAGAGGTTCAAGGCACAATATGT 60.019 41.667 0.00 0.00 0.00 2.29
1836 1918 6.541641 GCATGATGAATAAGAAGGACTCAAGT 59.458 38.462 0.00 0.00 0.00 3.16
1877 1959 1.822990 CAAGGCAGAGCAAATGGATGT 59.177 47.619 0.00 0.00 0.00 3.06
1917 1999 1.424493 GGAGGCTTGATCTTGACGCG 61.424 60.000 3.53 3.53 0.00 6.01
1960 2042 1.079819 CTCGAGGCGGAGAAGCAAA 60.080 57.895 3.91 0.00 39.27 3.68
2127 2209 0.994995 CCGACATGCTCAAGTTCGAG 59.005 55.000 0.00 0.00 36.02 4.04
2279 2379 1.518056 CGCCAGCATGAACTGTGGTT 61.518 55.000 0.00 0.00 39.69 3.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
309 325 2.034066 CGAGGCTTGCCTTTCCCA 59.966 61.111 15.92 0.0 0.00 4.37
641 682 0.966920 CTGTGGGTAGACGTGGAAGT 59.033 55.000 0.00 0.0 0.00 3.01
830 893 3.078837 GGCATTTCCTCGAACAGGTTAA 58.921 45.455 0.00 0.0 43.95 2.01
1095 1159 1.140052 TCGAACAAAGGCTCCACTTCA 59.860 47.619 0.00 0.0 0.00 3.02
1144 1214 3.858989 GCTCTTGCGCTTCGGCTC 61.859 66.667 9.73 0.0 39.13 4.70
1192 1263 2.833794 ACACTCGCAAAGAAGCTTGTA 58.166 42.857 2.10 0.0 0.00 2.41
1343 1414 0.035056 CCGCTTGGAAATGGAGACCT 60.035 55.000 0.00 0.0 33.02 3.85
1398 1469 1.219124 GACGCTCTCAAGGATGGCA 59.781 57.895 0.00 0.0 0.00 4.92
1457 1528 0.383231 GCGGCTTGCTTGCTATCATT 59.617 50.000 0.00 0.0 41.73 2.57
1571 1644 4.163441 TGAACCTTGAATGTCTCCACAA 57.837 40.909 0.00 0.0 35.64 3.33
1573 1646 5.705441 TGTATTGAACCTTGAATGTCTCCAC 59.295 40.000 0.00 0.0 0.00 4.02
1594 1667 2.295909 GGTTGAAGCACTTGCCATTGTA 59.704 45.455 0.00 0.0 43.38 2.41
1652 1725 2.477863 GCGACATATTGTGCCTTGAACC 60.478 50.000 0.00 0.0 0.00 3.62
1739 1818 1.068121 CTTGGAGTTGGTCTTCCCCT 58.932 55.000 0.00 0.0 0.00 4.79
1863 1945 4.773674 TCCATGAAAACATCCATTTGCTCT 59.226 37.500 0.00 0.0 0.00 4.09
1877 1959 4.292041 TCCTCCTTTGGATCTCCATGAAAA 59.708 41.667 0.00 0.0 46.97 2.29
1917 1999 1.831580 ACATCTTGGCTTGCTTCTCC 58.168 50.000 0.00 0.0 0.00 3.71
1960 2042 3.742640 GCCTCGATCTCTAGCATTTTGGT 60.743 47.826 0.00 0.0 0.00 3.67
2079 2161 1.004918 CTCGAACCACGGCCTCTTT 60.005 57.895 0.00 0.0 42.82 2.52
2127 2209 0.669077 ACGCCATAGATCACTCGTCC 59.331 55.000 0.00 0.0 0.00 4.79
2279 2379 5.698832 CATACAATGTCGGCTTCAGAAAAA 58.301 37.500 0.00 0.0 0.00 1.94


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.