Multiple sequence alignment - TraesCS1D01G234300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G234300 chr1D 100.000 2550 0 0 1 2550 322759981 322757432 0.000000e+00 4710.0
1 TraesCS1D01G234300 chr1D 97.257 2552 65 4 2 2550 322784717 322782168 0.000000e+00 4320.0
2 TraesCS1D01G234300 chr1D 92.704 2467 167 12 69 2530 322997390 322994932 0.000000e+00 3546.0
3 TraesCS1D01G234300 chr1D 91.974 2280 159 15 257 2530 322910567 322908306 0.000000e+00 3175.0
4 TraesCS1D01G234300 chr1D 92.118 2106 144 15 1 2095 323117429 323115335 0.000000e+00 2950.0
5 TraesCS1D01G234300 chr1D 93.127 2008 126 11 336 2337 323499881 323497880 0.000000e+00 2933.0
6 TraesCS1D01G234300 chr1D 93.502 1585 88 14 956 2530 322927026 322925447 0.000000e+00 2342.0
7 TraesCS1D01G234300 chr1D 88.374 972 61 9 1 971 322928777 322927857 0.000000e+00 1122.0
8 TraesCS1D01G234300 chr1D 90.429 303 28 1 1 303 323500154 323499853 5.110000e-107 398.0
9 TraesCS1D01G234300 chr1D 93.469 245 16 0 2093 2337 323107732 323107488 5.180000e-97 364.0
10 TraesCS1D01G234300 chr1D 89.615 260 25 2 1 260 322923034 322922777 1.890000e-86 329.0
11 TraesCS1D01G234300 chr1D 90.777 206 18 1 2326 2530 323050291 323050086 8.990000e-70 274.0
12 TraesCS1D01G234300 chr1D 100.000 35 0 0 305 339 323499888 323499854 5.890000e-07 65.8
13 TraesCS1D01G234300 chr1A 92.752 1490 98 7 762 2248 32801453 32799971 0.000000e+00 2145.0
14 TraesCS1D01G234300 chr1A 90.076 1320 98 11 130 1426 398893660 398892351 0.000000e+00 1681.0
15 TraesCS1D01G234300 chr1A 89.374 1167 93 10 198 1362 398860043 398858906 0.000000e+00 1439.0
16 TraesCS1D01G234300 chr1A 91.966 697 46 7 1557 2248 398843832 398843141 0.000000e+00 968.0
17 TraesCS1D01G234300 chr1A 90.881 636 52 5 132 766 32823262 32822632 0.000000e+00 848.0
18 TraesCS1D01G234300 chr1A 92.208 231 17 1 2019 2248 398890448 398890218 2.450000e-85 326.0
19 TraesCS1D01G234300 chr1A 95.000 140 6 1 1420 1559 398857347 398857209 4.270000e-53 219.0
20 TraesCS1D01G234300 chr1A 76.011 371 64 20 1310 1671 424393367 424393721 4.360000e-38 169.0
21 TraesCS1D01G234300 chr1A 79.439 107 15 4 45 146 62208158 62208262 4.550000e-08 69.4
22 TraesCS1D01G234300 chr1B 75.862 377 64 22 1310 1675 435813218 435813578 1.570000e-37 167.0
23 TraesCS1D01G234300 chr3D 79.268 246 37 8 1 232 116332215 116332460 2.630000e-35 159.0
24 TraesCS1D01G234300 chr3D 79.339 121 24 1 44 164 341514839 341514958 1.630000e-12 84.2
25 TraesCS1D01G234300 chr3B 77.510 249 37 12 1 232 169904355 169904601 5.720000e-27 132.0
26 TraesCS1D01G234300 chr2A 83.158 95 14 2 70 164 777450745 777450837 4.520000e-13 86.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G234300 chr1D 322757432 322759981 2549 True 4710.000000 4710 100.000000 1 2550 1 chr1D.!!$R1 2549
1 TraesCS1D01G234300 chr1D 322782168 322784717 2549 True 4320.000000 4320 97.257000 2 2550 1 chr1D.!!$R2 2548
2 TraesCS1D01G234300 chr1D 322994932 322997390 2458 True 3546.000000 3546 92.704000 69 2530 1 chr1D.!!$R4 2461
3 TraesCS1D01G234300 chr1D 322908306 322910567 2261 True 3175.000000 3175 91.974000 257 2530 1 chr1D.!!$R3 2273
4 TraesCS1D01G234300 chr1D 323115335 323117429 2094 True 2950.000000 2950 92.118000 1 2095 1 chr1D.!!$R7 2094
5 TraesCS1D01G234300 chr1D 322922777 322928777 6000 True 1264.333333 2342 90.497000 1 2530 3 chr1D.!!$R8 2529
6 TraesCS1D01G234300 chr1D 323497880 323500154 2274 True 1132.266667 2933 94.518667 1 2337 3 chr1D.!!$R9 2336
7 TraesCS1D01G234300 chr1A 32799971 32801453 1482 True 2145.000000 2145 92.752000 762 2248 1 chr1A.!!$R1 1486
8 TraesCS1D01G234300 chr1A 398890218 398893660 3442 True 1003.500000 1681 91.142000 130 2248 2 chr1A.!!$R5 2118
9 TraesCS1D01G234300 chr1A 398843141 398843832 691 True 968.000000 968 91.966000 1557 2248 1 chr1A.!!$R3 691
10 TraesCS1D01G234300 chr1A 32822632 32823262 630 True 848.000000 848 90.881000 132 766 1 chr1A.!!$R2 634
11 TraesCS1D01G234300 chr1A 398857209 398860043 2834 True 829.000000 1439 92.187000 198 1559 2 chr1A.!!$R4 1361

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
99 100 0.740737 CGCATCCAGGAAAATGGTCC 59.259 55.000 0.00 0.0 41.43 4.46 F
184 185 2.490991 GAGTTGGCCTAAGACGTGTTT 58.509 47.619 2.22 0.0 0.00 2.83 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1336 2241 1.275505 GGCTCGTACTTAAACTCGGC 58.724 55.000 0.0 0.0 0.00 5.54 R
1575 4088 7.525360 GCTCCCAAGTGAATCTTTATTTCCAAA 60.525 37.037 0.0 0.0 33.63 3.28 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
99 100 0.740737 CGCATCCAGGAAAATGGTCC 59.259 55.000 0.00 0.0 41.43 4.46
184 185 2.490991 GAGTTGGCCTAAGACGTGTTT 58.509 47.619 2.22 0.0 0.00 2.83
691 740 9.373603 ACTAATTAATTTTGCGGGGTTATTTTC 57.626 29.630 5.91 0.0 0.00 2.29
772 822 5.670792 TTTGTAGTCGGTCAATCCATACT 57.329 39.130 0.00 0.0 36.47 2.12
978 1874 4.219919 CAACCAAAAGGACTTAGGGGAAA 58.780 43.478 7.94 0.0 0.00 3.13
1010 1906 8.448615 AGTAAACAATTTCGTTATGGCTCTAAC 58.551 33.333 0.00 0.0 0.00 2.34
1575 4088 5.279156 GCAGGAAAATGACCAAGAATGAAGT 60.279 40.000 0.00 0.0 0.00 3.01
1675 4658 9.291664 CTTTTCCTATACTCTTTGTACTCGAAG 57.708 37.037 0.00 0.0 36.64 3.79
1993 5431 5.391843 CCCTTTCTTTTGCTTTTTGGTGTTG 60.392 40.000 0.00 0.0 0.00 3.33
1998 5436 7.032377 TCTTTTGCTTTTTGGTGTTGTTTTT 57.968 28.000 0.00 0.0 0.00 1.94
2000 5438 8.787852 TCTTTTGCTTTTTGGTGTTGTTTTTAT 58.212 25.926 0.00 0.0 0.00 1.40
2207 6092 0.099968 CAATGCAAGTCATGGCTCCG 59.900 55.000 0.00 0.0 35.13 4.63
2415 6301 1.096386 CGGTTTCGGTTGTTCCACCA 61.096 55.000 0.00 0.0 36.49 4.17
2484 6371 1.377536 GCCTCTCATGGTTTGCTCTC 58.622 55.000 0.00 0.0 0.00 3.20
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
99 100 0.887933 GTGGCAATGGGGTGTTGTAG 59.112 55.000 0.00 0.00 0.00 2.74
100 101 0.540830 GGTGGCAATGGGGTGTTGTA 60.541 55.000 0.00 0.00 0.00 2.41
159 160 0.914902 GTCTTAGGCCAACTCCCCCT 60.915 60.000 5.01 0.00 0.00 4.79
184 185 9.353431 ACAGATGCAACCACATAATATTATGAA 57.647 29.630 32.53 8.26 42.38 2.57
691 740 6.692681 CACAATTATGAAAGTTATTGCCTCCG 59.307 38.462 0.00 0.00 32.58 4.63
739 789 6.338146 TGACCGACTACAAAAATATCCAGAG 58.662 40.000 0.00 0.00 0.00 3.35
772 822 3.559655 GCACATCATGGAATACGCTGTTA 59.440 43.478 0.00 0.00 0.00 2.41
978 1874 8.974408 GCCATAACGAAATTGTTTACTCTTTTT 58.026 29.630 0.00 0.00 33.32 1.94
1010 1906 2.878406 AGAACACTTGTGTTGATTCGGG 59.122 45.455 21.74 0.00 31.35 5.14
1119 2019 4.655762 AGCGTCTCATAGTTGATAAGCA 57.344 40.909 0.00 0.00 36.41 3.91
1132 2032 2.028839 TCGTCCCAAAATAAGCGTCTCA 60.029 45.455 0.00 0.00 0.00 3.27
1285 2189 3.076621 CAGGCAAAACAGCTACTGATCA 58.923 45.455 0.78 0.00 35.18 2.92
1336 2241 1.275505 GGCTCGTACTTAAACTCGGC 58.724 55.000 0.00 0.00 0.00 5.54
1575 4088 7.525360 GCTCCCAAGTGAATCTTTATTTCCAAA 60.525 37.037 0.00 0.00 33.63 3.28
2207 6092 1.096386 CAGATTCTCAGCTGCTGGCC 61.096 60.000 27.79 13.08 43.05 5.36
2415 6301 1.780919 ACCTTAACTTCTGGTGGCCTT 59.219 47.619 3.32 0.00 32.16 4.35
2484 6371 1.802960 GCACATGACTCCTTGACTGTG 59.197 52.381 0.00 0.00 37.60 3.66


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.