Multiple sequence alignment - TraesCS1D01G205200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G205200 chr1D 100.000 2414 0 0 1 2414 290508987 290506574 0 4458
1 TraesCS1D01G205200 chr1D 97.738 619 12 2 1798 2414 254477022 254476404 0 1064
2 TraesCS1D01G205200 chr1D 95.624 617 26 1 1798 2414 244201315 244200700 0 989
3 TraesCS1D01G205200 chr1D 95.307 618 28 1 1798 2414 180356371 180356988 0 979
4 TraesCS1D01G205200 chrUn 98.268 924 11 3 870 1788 93410977 93411900 0 1613
5 TraesCS1D01G205200 chrUn 97.738 619 12 2 1798 2414 426380361 426380979 0 1064
6 TraesCS1D01G205200 chr2D 98.267 923 12 2 870 1788 272795240 272796162 0 1613
7 TraesCS1D01G205200 chr2D 97.738 619 12 2 1798 2414 648663279 648663897 0 1064
8 TraesCS1D01G205200 chr5D 98.261 920 15 1 870 1788 329121453 329122372 0 1609
9 TraesCS1D01G205200 chr5D 97.725 923 16 3 870 1788 503216871 503215950 0 1583
10 TraesCS1D01G205200 chr5D 92.807 848 59 2 1 847 237751518 237750672 0 1227
11 TraesCS1D01G205200 chr5D 97.415 619 14 2 1798 2414 503330935 503330317 0 1053
12 TraesCS1D01G205200 chr5D 96.921 617 19 0 1798 2414 6235877 6236493 0 1035
13 TraesCS1D01G205200 chr6D 97.727 924 15 4 870 1788 168250193 168249271 0 1585
14 TraesCS1D01G205200 chr3A 97.508 923 18 4 870 1788 672911356 672912277 0 1572
15 TraesCS1D01G205200 chr3A 94.089 829 47 2 1 827 468884360 468883532 0 1258
16 TraesCS1D01G205200 chr2A 96.750 923 23 4 870 1788 335829548 335828629 0 1531
17 TraesCS1D01G205200 chr6A 96.108 925 28 6 870 1788 260117627 260118549 0 1502
18 TraesCS1D01G205200 chr7A 95.652 920 37 3 870 1788 352183155 352184072 0 1474
19 TraesCS1D01G205200 chr3D 94.033 838 48 2 1 836 386052755 386053592 0 1269
20 TraesCS1D01G205200 chr3D 93.870 832 48 3 4 834 417864823 417863994 0 1251
21 TraesCS1D01G205200 chr1B 92.890 872 58 3 1 871 348528961 348529829 0 1264
22 TraesCS1D01G205200 chr5A 93.548 837 53 1 2 837 402475083 402475919 0 1245
23 TraesCS1D01G205200 chr4D 92.184 870 63 4 1 869 302045867 302045002 0 1225
24 TraesCS1D01G205200 chr5B 92.571 848 57 3 1 847 329976787 329977629 0 1212
25 TraesCS1D01G205200 chr7D 92.389 854 56 6 1 848 174932899 174933749 0 1208
26 TraesCS1D01G205200 chr1A 97.735 618 13 1 1798 2414 554447922 554448539 0 1062
27 TraesCS1D01G205200 chr3B 97.254 619 15 1 1798 2414 201493027 201492409 0 1048


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G205200 chr1D 290506574 290508987 2413 True 4458 4458 100.000 1 2414 1 chr1D.!!$R3 2413
1 TraesCS1D01G205200 chr1D 254476404 254477022 618 True 1064 1064 97.738 1798 2414 1 chr1D.!!$R2 616
2 TraesCS1D01G205200 chr1D 244200700 244201315 615 True 989 989 95.624 1798 2414 1 chr1D.!!$R1 616
3 TraesCS1D01G205200 chr1D 180356371 180356988 617 False 979 979 95.307 1798 2414 1 chr1D.!!$F1 616
4 TraesCS1D01G205200 chrUn 93410977 93411900 923 False 1613 1613 98.268 870 1788 1 chrUn.!!$F1 918
5 TraesCS1D01G205200 chrUn 426380361 426380979 618 False 1064 1064 97.738 1798 2414 1 chrUn.!!$F2 616
6 TraesCS1D01G205200 chr2D 272795240 272796162 922 False 1613 1613 98.267 870 1788 1 chr2D.!!$F1 918
7 TraesCS1D01G205200 chr2D 648663279 648663897 618 False 1064 1064 97.738 1798 2414 1 chr2D.!!$F2 616
8 TraesCS1D01G205200 chr5D 329121453 329122372 919 False 1609 1609 98.261 870 1788 1 chr5D.!!$F2 918
9 TraesCS1D01G205200 chr5D 503215950 503216871 921 True 1583 1583 97.725 870 1788 1 chr5D.!!$R2 918
10 TraesCS1D01G205200 chr5D 237750672 237751518 846 True 1227 1227 92.807 1 847 1 chr5D.!!$R1 846
11 TraesCS1D01G205200 chr5D 503330317 503330935 618 True 1053 1053 97.415 1798 2414 1 chr5D.!!$R3 616
12 TraesCS1D01G205200 chr5D 6235877 6236493 616 False 1035 1035 96.921 1798 2414 1 chr5D.!!$F1 616
13 TraesCS1D01G205200 chr6D 168249271 168250193 922 True 1585 1585 97.727 870 1788 1 chr6D.!!$R1 918
14 TraesCS1D01G205200 chr3A 672911356 672912277 921 False 1572 1572 97.508 870 1788 1 chr3A.!!$F1 918
15 TraesCS1D01G205200 chr3A 468883532 468884360 828 True 1258 1258 94.089 1 827 1 chr3A.!!$R1 826
16 TraesCS1D01G205200 chr2A 335828629 335829548 919 True 1531 1531 96.750 870 1788 1 chr2A.!!$R1 918
17 TraesCS1D01G205200 chr6A 260117627 260118549 922 False 1502 1502 96.108 870 1788 1 chr6A.!!$F1 918
18 TraesCS1D01G205200 chr7A 352183155 352184072 917 False 1474 1474 95.652 870 1788 1 chr7A.!!$F1 918
19 TraesCS1D01G205200 chr3D 386052755 386053592 837 False 1269 1269 94.033 1 836 1 chr3D.!!$F1 835
20 TraesCS1D01G205200 chr3D 417863994 417864823 829 True 1251 1251 93.870 4 834 1 chr3D.!!$R1 830
21 TraesCS1D01G205200 chr1B 348528961 348529829 868 False 1264 1264 92.890 1 871 1 chr1B.!!$F1 870
22 TraesCS1D01G205200 chr5A 402475083 402475919 836 False 1245 1245 93.548 2 837 1 chr5A.!!$F1 835
23 TraesCS1D01G205200 chr4D 302045002 302045867 865 True 1225 1225 92.184 1 869 1 chr4D.!!$R1 868
24 TraesCS1D01G205200 chr5B 329976787 329977629 842 False 1212 1212 92.571 1 847 1 chr5B.!!$F1 846
25 TraesCS1D01G205200 chr7D 174932899 174933749 850 False 1208 1208 92.389 1 848 1 chr7D.!!$F1 847
26 TraesCS1D01G205200 chr1A 554447922 554448539 617 False 1062 1062 97.735 1798 2414 1 chr1A.!!$F1 616
27 TraesCS1D01G205200 chr3B 201492409 201493027 618 True 1048 1048 97.254 1798 2414 1 chr3B.!!$R1 616

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
539 548 0.106708 TCAGAAGACAGCCACACCAC 59.893 55.0 0.0 0.0 0.0 4.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1867 1915 0.108281 GTCCTTCACTAACCGAGGCC 60.108 60.0 0.0 0.0 0.0 5.19 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
138 139 7.766738 TGCGTGTATGATAATAAGGAAAAGTGA 59.233 33.333 0.00 0.00 0.00 3.41
171 172 3.816523 CCAATTTTTGCAATGCTCAAGGT 59.183 39.130 6.82 0.00 0.00 3.50
246 248 9.504708 TCGTCCTAATTTCCAAATAAACTTACA 57.495 29.630 0.00 0.00 0.00 2.41
324 326 1.064825 CCAGTACCTCCACCCTTTGT 58.935 55.000 0.00 0.00 0.00 2.83
325 327 2.262637 CCAGTACCTCCACCCTTTGTA 58.737 52.381 0.00 0.00 0.00 2.41
326 328 2.236395 CCAGTACCTCCACCCTTTGTAG 59.764 54.545 0.00 0.00 0.00 2.74
373 375 2.251963 CGCACTTGCATCGCACAA 59.748 55.556 1.48 0.00 38.71 3.33
489 495 0.171231 CCGTTGAGCGTCATCAGAGA 59.829 55.000 0.00 0.00 39.32 3.10
539 548 0.106708 TCAGAAGACAGCCACACCAC 59.893 55.000 0.00 0.00 0.00 4.16
591 600 3.243401 GGGTGGTCTGTGATGTTCAAAAC 60.243 47.826 0.00 0.00 0.00 2.43
600 609 3.670055 GTGATGTTCAAAACTCCAATGCG 59.330 43.478 0.00 0.00 0.00 4.73
663 673 0.178909 ATCGATGAGAGGGGCCAGAT 60.179 55.000 4.39 0.00 0.00 2.90
675 685 1.457346 GGCCAGATGTCAAGAACCAG 58.543 55.000 0.00 0.00 0.00 4.00
924 963 7.834821 GGATACTAAATCTCGTCGTTAACTC 57.165 40.000 3.71 0.00 0.00 3.01
1386 1428 1.790838 CGAGCTCGAGGACGTAGTTTG 60.791 57.143 32.06 0.00 41.96 2.93
1710 1758 5.632347 ACTCAAGTTCCGAAGTAATTACACG 59.368 40.000 17.65 19.29 0.00 4.49
1788 1836 5.526111 TCCAAAAAGAAATCGATACGATCCC 59.474 40.000 0.00 3.14 46.30 3.85
1789 1837 5.527582 CCAAAAAGAAATCGATACGATCCCT 59.472 40.000 0.00 5.13 46.30 4.20
1790 1838 6.704493 CCAAAAAGAAATCGATACGATCCCTA 59.296 38.462 0.00 0.00 46.30 3.53
1791 1839 7.225931 CCAAAAAGAAATCGATACGATCCCTAA 59.774 37.037 0.00 0.00 46.30 2.69
1792 1840 8.774586 CAAAAAGAAATCGATACGATCCCTAAT 58.225 33.333 0.00 0.00 46.30 1.73
1793 1841 7.891183 AAAGAAATCGATACGATCCCTAATG 57.109 36.000 0.00 0.00 46.30 1.90
1794 1842 5.967088 AGAAATCGATACGATCCCTAATGG 58.033 41.667 0.00 0.00 46.30 3.16
1795 1843 5.715279 AGAAATCGATACGATCCCTAATGGA 59.285 40.000 0.00 0.00 46.30 3.41
1858 1906 6.122277 TCCTATTCTGGCATTTTCGATTTCT 58.878 36.000 0.00 0.00 0.00 2.52
1867 1915 5.119125 GGCATTTTCGATTTCTGGACTTTTG 59.881 40.000 0.00 0.00 0.00 2.44
1891 1939 2.561419 CTCGGTTAGTGAAGGACCAGAA 59.439 50.000 0.00 0.00 32.95 3.02
1949 1998 1.285078 GAGGGGCTTGGGTACAATTCT 59.715 52.381 0.00 0.00 35.73 2.40
2037 2086 1.134694 GGGCAATGAGTTTCGACGC 59.865 57.895 0.00 0.00 0.00 5.19
2234 2286 7.038154 CTTGACCAAACAAGTTCCAATTCTA 57.962 36.000 0.00 0.00 41.32 2.10
2267 2319 8.664798 CAACTACACCAAATGATCTTTCGAATA 58.335 33.333 0.00 0.00 0.00 1.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
138 139 0.747852 AAAAATTGGCGGTTCCGTGT 59.252 45.000 12.81 0.00 37.80 4.49
347 349 2.245096 GATGCAAGTGCGCTGTAAAAG 58.755 47.619 9.73 0.00 45.83 2.27
373 375 0.178903 TGGAGGTACTGGCTCAACCT 60.179 55.000 5.15 5.15 46.33 3.50
539 548 6.095860 CACTCATATATATTTGGGCCACATGG 59.904 42.308 15.39 0.00 38.53 3.66
591 600 1.666888 GGTCAAAGTTGCGCATTGGAG 60.667 52.381 12.75 1.59 0.00 3.86
600 609 1.008538 CCTGCGTGGTCAAAGTTGC 60.009 57.895 0.00 0.00 0.00 4.17
663 673 1.490490 ACTTCCAGCTGGTTCTTGACA 59.510 47.619 31.58 7.59 36.34 3.58
675 685 3.891366 ACATATATTTGGCCACTTCCAGC 59.109 43.478 3.88 0.00 37.44 4.85
960 999 6.183360 CCCGCCTACCTTTACTTTATTTTGAG 60.183 42.308 0.00 0.00 0.00 3.02
1041 1080 7.558081 AGTTTCCTTAGCTCACTTTTCTTCTTT 59.442 33.333 0.00 0.00 0.00 2.52
1055 1094 1.623811 TCCTTGCGAGTTTCCTTAGCT 59.376 47.619 0.00 0.00 0.00 3.32
1511 1557 7.021790 GTCTGAAACCGAGTGGATTTATTTTC 58.978 38.462 0.00 0.00 39.21 2.29
1710 1758 8.561738 TGAACCTGAGTCCATTTTTCTATTAC 57.438 34.615 0.00 0.00 0.00 1.89
1841 1889 3.441572 AGTCCAGAAATCGAAAATGCCAG 59.558 43.478 0.00 0.00 0.00 4.85
1858 1906 0.766131 TAACCGAGGCCAAAAGTCCA 59.234 50.000 5.01 0.00 0.00 4.02
1867 1915 0.108281 GTCCTTCACTAACCGAGGCC 60.108 60.000 0.00 0.00 0.00 5.19
1871 1919 2.297698 TCTGGTCCTTCACTAACCGA 57.702 50.000 0.00 0.00 35.76 4.69
1891 1939 6.415573 ACCCGATTCATAACTAGAAAGCTTT 58.584 36.000 12.53 12.53 0.00 3.51
1949 1998 6.367695 AGCGCAAACATATAATAGCGTATTCA 59.632 34.615 11.47 0.00 46.09 2.57
2037 2086 5.294799 TCGATAAAAACGGATACACCCAATG 59.705 40.000 0.00 0.00 34.64 2.82
2194 2246 6.442541 TGGTCAAGTAAGGGAAACTCAATA 57.557 37.500 0.00 0.00 0.00 1.90
2267 2319 5.128008 GCCATAAACTAGAGAGTCTTGACCT 59.872 44.000 0.00 0.00 33.58 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.