Multiple sequence alignment - TraesCS1D01G203800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G203800 chr1D 100.000 2468 0 0 1 2468 288858318 288860785 0.000000e+00 4558.0
1 TraesCS1D01G203800 chr7D 96.514 2467 76 5 2 2468 61524204 61521748 0.000000e+00 4071.0
2 TraesCS1D01G203800 chr4D 95.557 2093 72 2 377 2468 382848679 382846607 0.000000e+00 3330.0
3 TraesCS1D01G203800 chr1A 94.313 1653 79 8 1 1643 408631031 408632678 0.000000e+00 2518.0
4 TraesCS1D01G203800 chr1A 95.679 648 20 1 1829 2468 408632674 408633321 0.000000e+00 1035.0
5 TraesCS1D01G203800 chr1B 94.591 1627 79 7 1 1626 126921408 126923026 0.000000e+00 2508.0
6 TraesCS1D01G203800 chr1B 97.863 468 10 0 2000 2467 126923037 126923504 0.000000e+00 809.0
7 TraesCS1D01G203800 chr2A 95.159 1570 71 5 1 1570 494101286 494099722 0.000000e+00 2473.0
8 TraesCS1D01G203800 chr2A 95.089 1568 70 6 1 1567 354528934 354530495 0.000000e+00 2462.0
9 TraesCS1D01G203800 chr2A 96.436 477 11 1 1991 2467 354530492 354530962 0.000000e+00 782.0
10 TraesCS1D01G203800 chr2A 94.459 379 17 4 1 379 745975877 745975503 4.580000e-162 580.0
11 TraesCS1D01G203800 chr7A 94.707 1568 75 7 1 1567 320507544 320509104 0.000000e+00 2429.0
12 TraesCS1D01G203800 chr7A 96.646 477 16 0 1991 2467 320509101 320509577 0.000000e+00 793.0
13 TraesCS1D01G203800 chr2B 93.616 1629 89 12 1 1626 109886725 109888341 0.000000e+00 2418.0
14 TraesCS1D01G203800 chr2B 95.126 1190 56 2 437 1626 614643420 614644607 0.000000e+00 1875.0
15 TraesCS1D01G203800 chr2B 98.077 468 9 0 2000 2467 109888352 109888819 0.000000e+00 815.0
16 TraesCS1D01G203800 chr2B 98.077 468 9 0 2000 2467 614644618 614645085 0.000000e+00 815.0
17 TraesCS1D01G203800 chr5B 92.848 1650 78 10 1 1629 525550048 525548418 0.000000e+00 2357.0
18 TraesCS1D01G203800 chr5B 98.291 468 8 0 2000 2467 525548410 525547943 0.000000e+00 821.0
19 TraesCS1D01G203800 chr6A 95.968 372 11 3 8 379 87409846 87409479 3.510000e-168 601.0
20 TraesCS1D01G203800 chr6A 76.842 380 51 18 1490 1864 507128305 507128652 1.950000e-41 180.0
21 TraesCS1D01G203800 chr3A 95.026 382 14 3 1 379 34899585 34899206 1.630000e-166 595.0
22 TraesCS1D01G203800 chr7B 89.744 351 34 2 1515 1864 577562887 577562538 4.840000e-122 448.0
23 TraesCS1D01G203800 chr5D 81.306 337 51 10 1603 1938 247377784 247377459 1.880000e-66 263.0
24 TraesCS1D01G203800 chr3D 88.406 69 8 0 1947 2015 520360494 520360562 1.570000e-12 84.2


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G203800 chr1D 288858318 288860785 2467 False 4558.0 4558 100.0000 1 2468 1 chr1D.!!$F1 2467
1 TraesCS1D01G203800 chr7D 61521748 61524204 2456 True 4071.0 4071 96.5140 2 2468 1 chr7D.!!$R1 2466
2 TraesCS1D01G203800 chr4D 382846607 382848679 2072 True 3330.0 3330 95.5570 377 2468 1 chr4D.!!$R1 2091
3 TraesCS1D01G203800 chr1A 408631031 408633321 2290 False 1776.5 2518 94.9960 1 2468 2 chr1A.!!$F1 2467
4 TraesCS1D01G203800 chr1B 126921408 126923504 2096 False 1658.5 2508 96.2270 1 2467 2 chr1B.!!$F1 2466
5 TraesCS1D01G203800 chr2A 494099722 494101286 1564 True 2473.0 2473 95.1590 1 1570 1 chr2A.!!$R1 1569
6 TraesCS1D01G203800 chr2A 354528934 354530962 2028 False 1622.0 2462 95.7625 1 2467 2 chr2A.!!$F1 2466
7 TraesCS1D01G203800 chr7A 320507544 320509577 2033 False 1611.0 2429 95.6765 1 2467 2 chr7A.!!$F1 2466
8 TraesCS1D01G203800 chr2B 109886725 109888819 2094 False 1616.5 2418 95.8465 1 2467 2 chr2B.!!$F1 2466
9 TraesCS1D01G203800 chr2B 614643420 614645085 1665 False 1345.0 1875 96.6015 437 2467 2 chr2B.!!$F2 2030
10 TraesCS1D01G203800 chr5B 525547943 525550048 2105 True 1589.0 2357 95.5695 1 2467 2 chr5B.!!$R1 2466

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
534 580 1.064166 CCAGATCCAACCCAGCTCAAT 60.064 52.381 0.0 0.0 0.0 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2177 2236 1.02139 GCAGCGCTAGAAGAAAGGCA 61.021 55.0 10.99 0.0 0.0 4.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
358 392 3.555966 CCTAGGTCATTTTCCATCCACC 58.444 50.000 0.00 0.0 0.00 4.61
422 458 2.297597 CCTTCCAAGTCTTCTCTGTCGT 59.702 50.000 0.00 0.0 0.00 4.34
461 497 3.969976 TGATTCGATCCAATCCTCTCCTT 59.030 43.478 10.13 0.0 32.51 3.36
534 580 1.064166 CCAGATCCAACCCAGCTCAAT 60.064 52.381 0.00 0.0 0.00 2.57
623 669 1.750341 TTTCGGTCGCCTCCAACTCA 61.750 55.000 0.00 0.0 0.00 3.41
1145 1197 3.005554 CGCACATCAAGAAGGTGAGAAT 58.994 45.455 8.76 0.0 34.81 2.40
1224 1277 5.619220 AGACAGTCTTGCAAGAGAAAGAAT 58.381 37.500 29.13 10.7 41.11 2.40
1285 1338 1.878088 CTGCCGAATGATTGGATCTGG 59.122 52.381 0.00 0.0 30.72 3.86
1706 1759 8.070034 TGAAATCCCTTATCTGTACTTCGTTA 57.930 34.615 0.00 0.0 0.00 3.18
1736 1789 2.032030 CGCGGCCCTTTTAGAACATATG 60.032 50.000 0.00 0.0 0.00 1.78
1898 1951 1.032014 TGCCTTCACTTGGACAAAGC 58.968 50.000 0.00 0.0 39.76 3.51
2126 2185 5.968528 TGCGTTTGGTACTTGGAAATAAT 57.031 34.783 0.00 0.0 0.00 1.28
2177 2236 5.810587 CACGCCATGTAGTATACTGAAAACT 59.189 40.000 15.90 0.0 43.54 2.66
2209 2268 2.665777 CGCTGCTACACAACGCTAT 58.334 52.632 0.00 0.0 30.03 2.97
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
110 113 7.436933 AGAAAATGGAAAACCTTCTCATTGTC 58.563 34.615 0.00 0.00 37.09 3.18
294 319 2.511600 GAGGACGGCCGTTGGATG 60.512 66.667 34.65 0.00 39.96 3.51
439 475 3.581101 AGGAGAGGATTGGATCGAATCA 58.419 45.455 25.81 0.00 34.50 2.57
487 523 3.706373 GCGGGGCTGGTTGAGAGA 61.706 66.667 0.00 0.00 0.00 3.10
534 580 2.686106 GCGGGGTAGGAGTTGGGA 60.686 66.667 0.00 0.00 0.00 4.37
623 669 2.125673 CCGGAGCAACGTCGGATT 60.126 61.111 6.79 0.00 45.96 3.01
1077 1128 3.591254 GAAGCGGTCGAGTGCCCTT 62.591 63.158 5.26 0.66 0.00 3.95
1145 1197 1.143329 TGGGGGTGGTATTGGCAAGA 61.143 55.000 5.96 0.00 0.00 3.02
1224 1277 9.448438 ACTGCTTATTTATGTTCAAGTACATCA 57.552 29.630 0.00 0.00 39.39 3.07
1285 1338 2.639286 CAGTGCAGCCGTCCAAAC 59.361 61.111 0.00 0.00 0.00 2.93
1706 1759 1.460273 AAAGGGCCGCGTCAAACAAT 61.460 50.000 4.92 0.00 0.00 2.71
1736 1789 3.694072 TGGCACAACTAGGCATAACAATC 59.306 43.478 0.00 0.00 36.56 2.67
1801 1854 1.512996 GCACTCACACTGCACATGCT 61.513 55.000 5.31 0.00 42.66 3.79
2177 2236 1.021390 GCAGCGCTAGAAGAAAGGCA 61.021 55.000 10.99 0.00 0.00 4.75


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.