Multiple sequence alignment - TraesCS1D01G196300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G196300 chr1D 100.000 2234 0 0 1 2234 275786563 275788796 0 4126
1 TraesCS1D01G196300 chr1D 98.153 1895 23 4 352 2234 212445900 212447794 0 3295
2 TraesCS1D01G196300 chr7D 98.087 2248 29 4 1 2234 382089825 382087578 0 3901
3 TraesCS1D01G196300 chr7D 97.734 2251 31 6 1 2234 626711169 626713416 0 3856
4 TraesCS1D01G196300 chr7A 97.870 2254 28 6 1 2234 638507638 638509891 0 3879
5 TraesCS1D01G196300 chr7A 97.339 2255 37 8 1 2234 708245651 708243399 0 3810
6 TraesCS1D01G196300 chr7A 97.148 2244 53 5 1 2234 211364401 211366643 0 3779
7 TraesCS1D01G196300 chr6B 97.826 2254 28 7 1 2234 596601832 596604084 0 3871
8 TraesCS1D01G196300 chrUn 97.736 2253 32 5 1 2234 171008312 171006060 0 3860
9 TraesCS1D01G196300 chr4D 97.688 2249 36 5 1 2234 123401545 123399298 0 3851
10 TraesCS1D01G196300 chr5B 97.206 2255 42 7 1 2234 567280022 567277768 0 3795
11 TraesCS1D01G196300 chr1A 96.932 2249 52 7 1 2234 94580921 94578675 0 3755
12 TraesCS1D01G196300 chr3D 96.309 2249 54 7 1 2234 501886016 501883782 0 3666
13 TraesCS1D01G196300 chr3D 97.021 1309 28 3 937 2234 602860673 602861981 0 2191
14 TraesCS1D01G196300 chr3A 97.252 837 14 1 1407 2234 209413727 209414563 0 1410


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G196300 chr1D 275786563 275788796 2233 False 4126 4126 100.000 1 2234 1 chr1D.!!$F2 2233
1 TraesCS1D01G196300 chr1D 212445900 212447794 1894 False 3295 3295 98.153 352 2234 1 chr1D.!!$F1 1882
2 TraesCS1D01G196300 chr7D 382087578 382089825 2247 True 3901 3901 98.087 1 2234 1 chr7D.!!$R1 2233
3 TraesCS1D01G196300 chr7D 626711169 626713416 2247 False 3856 3856 97.734 1 2234 1 chr7D.!!$F1 2233
4 TraesCS1D01G196300 chr7A 638507638 638509891 2253 False 3879 3879 97.870 1 2234 1 chr7A.!!$F2 2233
5 TraesCS1D01G196300 chr7A 708243399 708245651 2252 True 3810 3810 97.339 1 2234 1 chr7A.!!$R1 2233
6 TraesCS1D01G196300 chr7A 211364401 211366643 2242 False 3779 3779 97.148 1 2234 1 chr7A.!!$F1 2233
7 TraesCS1D01G196300 chr6B 596601832 596604084 2252 False 3871 3871 97.826 1 2234 1 chr6B.!!$F1 2233
8 TraesCS1D01G196300 chrUn 171006060 171008312 2252 True 3860 3860 97.736 1 2234 1 chrUn.!!$R1 2233
9 TraesCS1D01G196300 chr4D 123399298 123401545 2247 True 3851 3851 97.688 1 2234 1 chr4D.!!$R1 2233
10 TraesCS1D01G196300 chr5B 567277768 567280022 2254 True 3795 3795 97.206 1 2234 1 chr5B.!!$R1 2233
11 TraesCS1D01G196300 chr1A 94578675 94580921 2246 True 3755 3755 96.932 1 2234 1 chr1A.!!$R1 2233
12 TraesCS1D01G196300 chr3D 501883782 501886016 2234 True 3666 3666 96.309 1 2234 1 chr3D.!!$R1 2233
13 TraesCS1D01G196300 chr3D 602860673 602861981 1308 False 2191 2191 97.021 937 2234 1 chr3D.!!$F1 1297
14 TraesCS1D01G196300 chr3A 209413727 209414563 836 False 1410 1410 97.252 1407 2234 1 chr3A.!!$F1 827

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
159 163 0.954449 TCTCGTCTTTCTCTCGGCGT 60.954 55.0 6.85 0.0 0.0 5.68 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1752 1785 0.121197 ACCCTCCTTGAGATTCCCCA 59.879 55.0 0.0 0.0 0.0 4.96 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
159 163 0.954449 TCTCGTCTTTCTCTCGGCGT 60.954 55.000 6.85 0.0 0.00 5.68
350 359 6.732487 CCCCCTTTACCTTCTCTTTCTATTT 58.268 40.000 0.00 0.0 0.00 1.40
665 674 1.216977 CCGTCACCTGTAATCCGCA 59.783 57.895 0.00 0.0 0.00 5.69
878 892 2.502510 GCGGTTCATTGCTGTGCG 60.503 61.111 0.00 0.0 0.00 5.34
1298 1316 1.071857 AGTTTTTGGGGTCCTCGAGAC 59.928 52.381 15.71 10.1 45.51 3.36
1511 1530 2.174639 TCAAAAGGAGAAGCCCTGAACA 59.825 45.455 0.00 0.0 36.49 3.18
1637 1665 0.560688 TTTTGAGGAGTTTGCCCCCT 59.439 50.000 0.00 0.0 0.00 4.79
1752 1785 0.961857 GGGTGGCGTTTCCGGTAAAT 60.962 55.000 0.00 0.0 37.80 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
159 163 2.473609 CGGACACGTCAAAAATTCTCGA 59.526 45.455 0.00 0.0 34.81 4.04
612 621 2.108970 GGGAAGTGAAGAGTACCCGAT 58.891 52.381 0.00 0.0 0.00 4.18
878 892 3.363627 AGAAGGGTAGCCTAGTGTGTAC 58.636 50.000 15.26 0.0 0.00 2.90
1298 1316 3.132289 TCTCTACTGGACCTAAAATGCGG 59.868 47.826 0.00 0.0 0.00 5.69
1312 1330 2.158871 AGACTCCCTAGCGTCTCTACTG 60.159 54.545 2.78 0.0 35.72 2.74
1529 1548 5.071115 AGGCTCGCTTAGAAGGAATAAAGAT 59.929 40.000 0.00 0.0 0.00 2.40
1752 1785 0.121197 ACCCTCCTTGAGATTCCCCA 59.879 55.000 0.00 0.0 0.00 4.96
2171 2207 2.971901 AGGGGTGGTGAAACTTTAGG 57.028 50.000 0.00 0.0 36.74 2.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.