Multiple sequence alignment - TraesCS1D01G196200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G196200 chr1D 100.000 2342 0 0 1 2342 275778828 275781169 0.000000e+00 4325.0
1 TraesCS1D01G196200 chr7A 98.199 2332 39 2 1 2331 60084836 60087165 0.000000e+00 4071.0
2 TraesCS1D01G196200 chr7A 98.113 2332 41 2 1 2331 60168867 60166538 0.000000e+00 4060.0
3 TraesCS1D01G196200 chr5A 98.199 2332 39 2 1 2331 16544454 16546783 0.000000e+00 4071.0
4 TraesCS1D01G196200 chr5A 97.556 2332 42 3 1 2331 420185602 420187919 0.000000e+00 3976.0
5 TraesCS1D01G196200 chr5A 90.438 251 18 2 2046 2296 327918944 327918700 2.240000e-85 326.0
6 TraesCS1D01G196200 chr5A 100.000 38 0 0 2016 2053 505903239 505903202 1.160000e-08 71.3
7 TraesCS1D01G196200 chr7B 98.156 2332 40 2 1 2331 716784507 716786836 0.000000e+00 4065.0
8 TraesCS1D01G196200 chr7B 98.113 2332 41 2 1 2331 742948838 742946509 0.000000e+00 4060.0
9 TraesCS1D01G196200 chr7B 95.211 2297 90 7 39 2331 139608300 139610580 0.000000e+00 3615.0
10 TraesCS1D01G196200 chr6B 96.098 2332 74 8 1 2331 388287137 388284822 0.000000e+00 3786.0
11 TraesCS1D01G196200 chr2D 95.328 2333 84 11 1 2331 291773519 291775828 0.000000e+00 3681.0
12 TraesCS1D01G196200 chr2B 96.825 189 6 0 2143 2331 102608845 102609033 1.350000e-82 316.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G196200 chr1D 275778828 275781169 2341 False 4325 4325 100.000 1 2342 1 chr1D.!!$F1 2341
1 TraesCS1D01G196200 chr7A 60084836 60087165 2329 False 4071 4071 98.199 1 2331 1 chr7A.!!$F1 2330
2 TraesCS1D01G196200 chr7A 60166538 60168867 2329 True 4060 4060 98.113 1 2331 1 chr7A.!!$R1 2330
3 TraesCS1D01G196200 chr5A 16544454 16546783 2329 False 4071 4071 98.199 1 2331 1 chr5A.!!$F1 2330
4 TraesCS1D01G196200 chr5A 420185602 420187919 2317 False 3976 3976 97.556 1 2331 1 chr5A.!!$F2 2330
5 TraesCS1D01G196200 chr7B 716784507 716786836 2329 False 4065 4065 98.156 1 2331 1 chr7B.!!$F2 2330
6 TraesCS1D01G196200 chr7B 742946509 742948838 2329 True 4060 4060 98.113 1 2331 1 chr7B.!!$R1 2330
7 TraesCS1D01G196200 chr7B 139608300 139610580 2280 False 3615 3615 95.211 39 2331 1 chr7B.!!$F1 2292
8 TraesCS1D01G196200 chr6B 388284822 388287137 2315 True 3786 3786 96.098 1 2331 1 chr6B.!!$R1 2330
9 TraesCS1D01G196200 chr2D 291773519 291775828 2309 False 3681 3681 95.328 1 2331 1 chr2D.!!$F1 2330

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
362 364 0.390866 CTTGATGCTGCGACTCAGGT 60.391 55.0 0.0 0.0 43.06 4.0 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2086 2093 1.531578 GTCGTCTTTGGTTTGGAGCTC 59.468 52.381 4.71 4.71 0.0 4.09 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
200 202 5.406780 CAGAGCTCTTTTATCGCGGAATTAT 59.593 40.000 15.27 0.0 0.00 1.28
291 293 4.595762 AGTCTGCGGTAGTTCAAAACTA 57.404 40.909 0.00 0.0 42.81 2.24
362 364 0.390866 CTTGATGCTGCGACTCAGGT 60.391 55.000 0.00 0.0 43.06 4.00
394 396 2.106511 AGAGGTGCAAGGCTTACAGAAA 59.893 45.455 0.00 0.0 0.00 2.52
503 505 3.849911 TGCCACTAGACAGAATTTCTCG 58.150 45.455 0.00 0.0 0.00 4.04
594 596 7.065923 GGCTTAACTAACGAAAGAAAGATGGAT 59.934 37.037 0.00 0.0 0.00 3.41
666 668 2.818274 GGTTGCCCCTTACTCGCG 60.818 66.667 0.00 0.0 0.00 5.87
912 914 9.293404 CTATACCTGATGATTTTCAATCCACAT 57.707 33.333 0.00 0.0 0.00 3.21
1265 1267 2.235402 CCATTTTGGGCTTTGCTCTCAT 59.765 45.455 0.00 0.0 32.67 2.90
1326 1329 4.754322 TGATCTCATTCGTTTTCCGATCA 58.246 39.130 0.00 0.0 46.75 2.92
1440 1443 2.987413 TTGGATGATGTGCGTTTCAC 57.013 45.000 0.00 0.0 45.82 3.18
1464 1467 8.597227 CACCAAGTATGAACATATTGCATTTTG 58.403 33.333 0.00 0.0 0.00 2.44
1790 1795 5.295045 TGTGTCTTTCCGTTTAAGGTCTTTC 59.705 40.000 0.00 0.0 0.00 2.62
1792 1797 6.017357 GTGTCTTTCCGTTTAAGGTCTTTCAT 60.017 38.462 0.00 0.0 0.00 2.57
1793 1798 6.544564 TGTCTTTCCGTTTAAGGTCTTTCATT 59.455 34.615 0.00 0.0 0.00 2.57
1910 1915 1.663643 CGACTTCAGAGAGGAGAGACG 59.336 57.143 0.00 0.0 0.00 4.18
1918 1923 3.254657 CAGAGAGGAGAGACGTGAACTTT 59.745 47.826 0.00 0.0 0.00 2.66
2086 2093 3.703001 AGCCTATACATCCGGGAATTG 57.297 47.619 0.00 0.0 0.00 2.32
2306 2313 4.985538 AGTTGCCTATCTTTCTTGGTTCA 58.014 39.130 0.00 0.0 0.00 3.18
2339 2346 2.810439 TTGAAAACAAAGCCCGATGG 57.190 45.000 0.00 0.0 0.00 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
70 72 0.169672 GGTAACGCAGTCGAGCTACA 59.830 55.000 0.00 0.00 45.00 2.74
170 172 3.242123 GCGATAAAAGAGCTCTGTTTCCG 60.242 47.826 24.05 24.27 0.00 4.30
200 202 3.899052 AGCCAACGTTAATAGCTGGTA 57.101 42.857 0.00 0.00 31.23 3.25
291 293 2.560504 TCGCGATATTGTGCCAATTCT 58.439 42.857 3.71 0.00 0.00 2.40
362 364 5.366768 AGCCTTGCACCTCTATTGAGTAATA 59.633 40.000 3.47 0.00 38.61 0.98
394 396 3.837146 TCATATTGTGGTTGTTTGGGCAT 59.163 39.130 0.00 0.00 0.00 4.40
666 668 4.849518 AGAAAAGCCTTCTTCCTACATCC 58.150 43.478 0.00 0.00 0.00 3.51
924 926 5.973899 TTTGCAAGGCTTGTCACATATTA 57.026 34.783 26.71 7.94 0.00 0.98
1354 1357 9.803315 TTACATCTGTAACTACATTCTCACATC 57.197 33.333 0.00 0.00 35.75 3.06
1440 1443 8.597227 CACAAAATGCAATATGTTCATACTTGG 58.403 33.333 0.00 0.00 0.00 3.61
1464 1467 3.242739 CCGGTACTGAAATTGCATAGCAC 60.243 47.826 2.31 0.00 38.71 4.40
1640 1643 2.582052 TGGTGACAGCCGAAGAAAAAT 58.418 42.857 1.47 0.00 35.01 1.82
1790 1795 3.405170 ACGAAGCTAATGCCGAAAATG 57.595 42.857 0.00 0.00 40.80 2.32
1792 1797 4.247258 TCTAACGAAGCTAATGCCGAAAA 58.753 39.130 0.00 0.00 40.80 2.29
1793 1798 3.852286 TCTAACGAAGCTAATGCCGAAA 58.148 40.909 0.00 0.00 40.80 3.46
1918 1923 5.163834 CGTATGCCTTTTCTACGCCTAAAAA 60.164 40.000 0.00 0.00 32.83 1.94
2086 2093 1.531578 GTCGTCTTTGGTTTGGAGCTC 59.468 52.381 4.71 4.71 0.00 4.09
2306 2313 6.729690 TTGTTTTCAACTGGATTGGATTCT 57.270 33.333 0.00 0.00 38.98 2.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.