Multiple sequence alignment - TraesCS1D01G196100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G196100 chr1D 100.000 2822 0 0 1 2822 275776945 275779766 0 5212
1 TraesCS1D01G196100 chr1D 97.952 2832 47 3 1 2822 185745753 185742923 0 4898
2 TraesCS1D01G196100 chr7B 98.446 2832 34 2 1 2822 742950730 742947899 0 4977
3 TraesCS1D01G196100 chr7B 97.847 2833 49 4 1 2822 716782615 716785446 0 4883
4 TraesCS1D01G196100 chr2A 98.412 2833 34 3 1 2822 755478556 755481388 0 4972
5 TraesCS1D01G196100 chr7A 98.270 2832 39 2 1 2822 60170759 60167928 0 4950
6 TraesCS1D01G196100 chr7A 98.306 2657 33 4 176 2822 60083121 60085775 0 4647
7 TraesCS1D01G196100 chr5A 98.164 2832 41 3 1 2822 420183711 420186541 0 4931
8 TraesCS1D01G196100 chr5A 98.315 2790 37 2 43 2822 16542604 16545393 0 4883
9 TraesCS1D01G196100 chr4D 98.058 2832 44 3 1 2822 123348130 123350960 0 4915
10 TraesCS1D01G196100 chr2D 97.952 2832 48 2 1 2822 200924305 200927136 0 4900
11 TraesCS1D01G196100 chr6A 97.917 2832 49 2 1 2822 155855307 155858138 0 4894
12 TraesCS1D01G196100 chr1B 97.947 2777 46 3 1 2767 583563540 583560765 0 4802
13 TraesCS1D01G196100 chr2B 97.879 2452 40 4 1 2441 391098662 391101112 0 4229
14 TraesCS1D01G196100 chrUn 98.076 1663 22 2 1170 2822 378555716 378557378 0 2885


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G196100 chr1D 275776945 275779766 2821 False 5212 5212 100.000 1 2822 1 chr1D.!!$F1 2821
1 TraesCS1D01G196100 chr1D 185742923 185745753 2830 True 4898 4898 97.952 1 2822 1 chr1D.!!$R1 2821
2 TraesCS1D01G196100 chr7B 742947899 742950730 2831 True 4977 4977 98.446 1 2822 1 chr7B.!!$R1 2821
3 TraesCS1D01G196100 chr7B 716782615 716785446 2831 False 4883 4883 97.847 1 2822 1 chr7B.!!$F1 2821
4 TraesCS1D01G196100 chr2A 755478556 755481388 2832 False 4972 4972 98.412 1 2822 1 chr2A.!!$F1 2821
5 TraesCS1D01G196100 chr7A 60167928 60170759 2831 True 4950 4950 98.270 1 2822 1 chr7A.!!$R1 2821
6 TraesCS1D01G196100 chr7A 60083121 60085775 2654 False 4647 4647 98.306 176 2822 1 chr7A.!!$F1 2646
7 TraesCS1D01G196100 chr5A 420183711 420186541 2830 False 4931 4931 98.164 1 2822 1 chr5A.!!$F2 2821
8 TraesCS1D01G196100 chr5A 16542604 16545393 2789 False 4883 4883 98.315 43 2822 1 chr5A.!!$F1 2779
9 TraesCS1D01G196100 chr4D 123348130 123350960 2830 False 4915 4915 98.058 1 2822 1 chr4D.!!$F1 2821
10 TraesCS1D01G196100 chr2D 200924305 200927136 2831 False 4900 4900 97.952 1 2822 1 chr2D.!!$F1 2821
11 TraesCS1D01G196100 chr6A 155855307 155858138 2831 False 4894 4894 97.917 1 2822 1 chr6A.!!$F1 2821
12 TraesCS1D01G196100 chr1B 583560765 583563540 2775 True 4802 4802 97.947 1 2767 1 chr1B.!!$R1 2766
13 TraesCS1D01G196100 chr2B 391098662 391101112 2450 False 4229 4229 97.879 1 2441 1 chr2B.!!$F1 2440
14 TraesCS1D01G196100 chrUn 378555716 378557378 1662 False 2885 2885 98.076 1170 2822 1 chrUn.!!$F1 1652

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
79 80 2.50161 GCCTCTAGTTCCGGCAGG 59.498 66.667 0.0 0.0 43.25 4.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1953 1966 0.169672 GGTAACGCAGTCGAGCTACA 59.83 55.0 0.0 0.0 45.0 2.74 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
79 80 2.501610 GCCTCTAGTTCCGGCAGG 59.498 66.667 0.00 0.0 43.25 4.85
528 529 3.868077 GTCAGGAAGACTCGGAATCATTG 59.132 47.826 0.00 0.0 44.09 2.82
533 534 4.499183 GAAGACTCGGAATCATTGTCACT 58.501 43.478 0.00 0.0 0.00 3.41
1906 1918 6.265422 CCCAGGGGATGTTTTCTATTTACATC 59.735 42.308 0.00 0.0 44.60 3.06
2083 2096 5.406780 CAGAGCTCTTTTATCGCGGAATTAT 59.593 40.000 15.27 0.0 0.00 1.28
2174 2187 4.595762 AGTCTGCGGTAGTTCAAAACTA 57.404 40.909 0.00 0.0 42.81 2.24
2245 2258 0.390866 CTTGATGCTGCGACTCAGGT 60.391 55.000 0.00 0.0 43.06 4.00
2277 2290 2.106511 AGAGGTGCAAGGCTTACAGAAA 59.893 45.455 0.00 0.0 0.00 2.52
2386 2399 3.849911 TGCCACTAGACAGAATTTCTCG 58.150 45.455 0.00 0.0 0.00 4.04
2477 2490 7.065923 GGCTTAACTAACGAAAGAAAGATGGAT 59.934 37.037 0.00 0.0 0.00 3.41
2549 2562 2.818274 GGTTGCCCCTTACTCGCG 60.818 66.667 0.00 0.0 0.00 5.87
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
490 491 1.073763 CTGACCAGACCCATGTGGAAA 59.926 52.381 7.06 0.00 42.06 3.13
528 529 2.594592 GTGTGGGGTGGCAGTGAC 60.595 66.667 0.00 0.00 0.00 3.67
1810 1822 2.908916 TGCCACCGCCTATTTACTTAC 58.091 47.619 0.00 0.00 0.00 2.34
1819 1831 1.110518 TGTCGATATGCCACCGCCTA 61.111 55.000 0.00 0.00 0.00 3.93
1953 1966 0.169672 GGTAACGCAGTCGAGCTACA 59.830 55.000 0.00 0.00 45.00 2.74
2053 2066 3.242123 GCGATAAAAGAGCTCTGTTTCCG 60.242 47.826 24.05 24.27 0.00 4.30
2083 2096 3.899052 AGCCAACGTTAATAGCTGGTA 57.101 42.857 0.00 0.00 31.23 3.25
2174 2187 2.560504 TCGCGATATTGTGCCAATTCT 58.439 42.857 3.71 0.00 0.00 2.40
2245 2258 5.366768 AGCCTTGCACCTCTATTGAGTAATA 59.633 40.000 3.47 0.00 38.61 0.98
2277 2290 3.837146 TCATATTGTGGTTGTTTGGGCAT 59.163 39.130 0.00 0.00 0.00 4.40
2549 2562 4.849518 AGAAAAGCCTTCTTCCTACATCC 58.150 43.478 0.00 0.00 0.00 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.