Multiple sequence alignment - TraesCS1D01G193500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G193500 chr1D 100.000 2342 0 0 1 2342 269426863 269424522 0 4325
1 TraesCS1D01G193500 chr1D 96.983 1359 26 1 1 1344 185743876 185742518 0 2268
2 TraesCS1D01G193500 chr4D 96.781 2361 57 5 1 2342 123350007 123352367 0 3921
3 TraesCS1D01G193500 chr4D 95.980 2363 74 4 1 2342 134979309 134981671 0 3818
4 TraesCS1D01G193500 chr4D 95.917 2351 79 5 1 2337 240994889 240992542 0 3794
5 TraesCS1D01G193500 chr4D 97.141 1644 43 4 703 2342 123561662 123563305 0 2772
6 TraesCS1D01G193500 chr4D 94.123 1140 56 7 708 1844 450897577 450896446 0 1724
7 TraesCS1D01G193500 chr6D 96.803 2346 69 3 1 2342 370022403 370024746 0 3912
8 TraesCS1D01G193500 chr6D 96.810 1160 36 1 1184 2342 369972796 369971637 0 1936
9 TraesCS1D01G193500 chr5D 96.312 2359 67 6 1 2342 301054286 301056641 0 3856
10 TraesCS1D01G193500 chr6A 93.607 2362 99 19 1 2342 79195835 79198164 0 3478
11 TraesCS1D01G193500 chr7B 97.331 1424 22 6 1 1408 742948852 742947429 0 2405
12 TraesCS1D01G193500 chr5A 97.326 1421 22 6 1 1405 420185588 420187008 0 2399
13 TraesCS1D01G193500 chr5A 97.115 1421 25 6 1 1405 16544440 16545860 0 2383
14 TraesCS1D01G193500 chr7A 97.255 1421 23 6 1 1405 60084822 60086242 0 2394
15 TraesCS1D01G193500 chr2A 97.044 1421 26 2 1 1405 755480435 755481855 0 2377
16 TraesCS1D01G193500 chr7D 97.537 1218 28 2 1127 2342 382029169 382027952 0 2082
17 TraesCS1D01G193500 chr7D 99.062 640 6 0 1 640 579041620 579042259 0 1149
18 TraesCS1D01G193500 chrUn 97.160 986 13 5 1 971 378556425 378557410 0 1652
19 TraesCS1D01G193500 chrUn 96.429 868 15 5 554 1405 417899047 417899914 0 1417


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G193500 chr1D 269424522 269426863 2341 True 4325 4325 100.000 1 2342 1 chr1D.!!$R2 2341
1 TraesCS1D01G193500 chr1D 185742518 185743876 1358 True 2268 2268 96.983 1 1344 1 chr1D.!!$R1 1343
2 TraesCS1D01G193500 chr4D 123350007 123352367 2360 False 3921 3921 96.781 1 2342 1 chr4D.!!$F1 2341
3 TraesCS1D01G193500 chr4D 134979309 134981671 2362 False 3818 3818 95.980 1 2342 1 chr4D.!!$F3 2341
4 TraesCS1D01G193500 chr4D 240992542 240994889 2347 True 3794 3794 95.917 1 2337 1 chr4D.!!$R1 2336
5 TraesCS1D01G193500 chr4D 123561662 123563305 1643 False 2772 2772 97.141 703 2342 1 chr4D.!!$F2 1639
6 TraesCS1D01G193500 chr4D 450896446 450897577 1131 True 1724 1724 94.123 708 1844 1 chr4D.!!$R2 1136
7 TraesCS1D01G193500 chr6D 370022403 370024746 2343 False 3912 3912 96.803 1 2342 1 chr6D.!!$F1 2341
8 TraesCS1D01G193500 chr6D 369971637 369972796 1159 True 1936 1936 96.810 1184 2342 1 chr6D.!!$R1 1158
9 TraesCS1D01G193500 chr5D 301054286 301056641 2355 False 3856 3856 96.312 1 2342 1 chr5D.!!$F1 2341
10 TraesCS1D01G193500 chr6A 79195835 79198164 2329 False 3478 3478 93.607 1 2342 1 chr6A.!!$F1 2341
11 TraesCS1D01G193500 chr7B 742947429 742948852 1423 True 2405 2405 97.331 1 1408 1 chr7B.!!$R1 1407
12 TraesCS1D01G193500 chr5A 420185588 420187008 1420 False 2399 2399 97.326 1 1405 1 chr5A.!!$F2 1404
13 TraesCS1D01G193500 chr5A 16544440 16545860 1420 False 2383 2383 97.115 1 1405 1 chr5A.!!$F1 1404
14 TraesCS1D01G193500 chr7A 60084822 60086242 1420 False 2394 2394 97.255 1 1405 1 chr7A.!!$F1 1404
15 TraesCS1D01G193500 chr2A 755480435 755481855 1420 False 2377 2377 97.044 1 1405 1 chr2A.!!$F1 1404
16 TraesCS1D01G193500 chr7D 382027952 382029169 1217 True 2082 2082 97.537 1127 2342 1 chr7D.!!$R1 1215
17 TraesCS1D01G193500 chr7D 579041620 579042259 639 False 1149 1149 99.062 1 640 1 chr7D.!!$F1 639
18 TraesCS1D01G193500 chrUn 378556425 378557410 985 False 1652 1652 97.160 1 971 1 chrUn.!!$F1 970
19 TraesCS1D01G193500 chrUn 417899047 417899914 867 False 1417 1417 96.429 554 1405 1 chrUn.!!$F2 851

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
793 810 0.972983 GCTGAGAGTCTACCCCAGCA 60.973 60.0 20.88 1.8 46.68 4.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1931 1960 0.030908 GAGGCTATTGCTCTACGCGT 59.969 55.0 19.17 19.17 43.27 6.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
168 169 4.385643 CCCACCAATGTGATCTCCATTACT 60.386 45.833 9.80 0.00 45.76 2.24
507 508 3.638627 TCTGTGATCGAATGCCACTAGAT 59.361 43.478 0.00 0.00 0.00 1.98
689 706 5.942826 CAGATGTAGGAAGAAGGCTTTTCTT 59.057 40.000 13.98 13.98 41.08 2.52
793 810 0.972983 GCTGAGAGTCTACCCCAGCA 60.973 60.000 20.88 1.80 46.68 4.41
794 811 1.110442 CTGAGAGTCTACCCCAGCAG 58.890 60.000 0.00 0.00 0.00 4.24
1446 1467 5.818136 TTGATTTTGACGATTGGATCTCC 57.182 39.130 0.00 0.00 0.00 3.71
1538 1562 2.430694 AGTCTAAGCGACATATGGCACA 59.569 45.455 9.77 0.00 45.32 4.57
1622 1651 6.884280 GGGGGACTTTTCATAGTTATCATG 57.116 41.667 0.00 0.00 0.00 3.07
1931 1960 2.659016 CTCGAGCAGGAACAGCCA 59.341 61.111 0.00 0.00 43.90 4.75
2143 2172 7.174946 CGTTCTGGGTATGCTCCAATTAAATAT 59.825 37.037 0.00 0.00 33.36 1.28
2168 2197 7.350382 TCAGTTTGAATGGGGCATTACTATTA 58.650 34.615 0.00 0.00 33.90 0.98
2170 2199 8.084073 CAGTTTGAATGGGGCATTACTATTATG 58.916 37.037 0.00 0.00 33.90 1.90
2225 2256 2.972713 CCTTTCGGATCCTGGGAATCTA 59.027 50.000 10.75 0.00 0.00 1.98
2338 2369 3.688086 GTCGCAGGACTCCAGACT 58.312 61.111 0.00 0.00 40.15 3.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
168 169 7.232330 TCTGTTTCCAAACATATTTGTCCATCA 59.768 33.333 5.35 0.00 46.71 3.07
507 508 8.821686 TGGCCTTTTCATATTGAGAAATTCTA 57.178 30.769 3.32 0.00 35.17 2.10
528 529 8.594550 TCAGGATTAATAGTACTTAGAATGGCC 58.405 37.037 0.00 0.00 0.00 5.36
689 706 1.272425 CCTATTGGGGTTCAGTTGGCA 60.272 52.381 0.00 0.00 0.00 4.92
803 820 0.107945 CCTGAACTACTGGAGCAGCC 60.108 60.000 0.00 0.00 39.52 4.85
1091 1110 3.057456 AGCACGTTCTAACATCTCGAGTT 60.057 43.478 13.13 0.15 0.00 3.01
1108 1127 2.032894 CGGCACCTATTGATTTAGCACG 60.033 50.000 0.00 0.00 0.00 5.34
1298 1317 6.881065 TCGGAAAATGAATGAGATCAGAAAGT 59.119 34.615 0.00 0.00 31.76 2.66
1446 1467 2.695147 GCACCCCTTTTCCATTCATAGG 59.305 50.000 0.00 0.00 0.00 2.57
1538 1562 7.870954 GTCTTACCGAAATTGGATTTCCTTTTT 59.129 33.333 7.58 0.00 44.40 1.94
1622 1651 6.636562 TCTACTACTAAAGCAGCTATCACC 57.363 41.667 0.00 0.00 0.00 4.02
1730 1759 5.600696 ACCATTTCTTCAATCAGCGTTTTT 58.399 33.333 0.00 0.00 0.00 1.94
1731 1760 5.200368 ACCATTTCTTCAATCAGCGTTTT 57.800 34.783 0.00 0.00 0.00 2.43
1732 1761 4.853924 ACCATTTCTTCAATCAGCGTTT 57.146 36.364 0.00 0.00 0.00 3.60
1733 1762 4.156008 GGTACCATTTCTTCAATCAGCGTT 59.844 41.667 7.15 0.00 0.00 4.84
1931 1960 0.030908 GAGGCTATTGCTCTACGCGT 59.969 55.000 19.17 19.17 43.27 6.01
1944 1973 3.562343 ATCTACTGACAGACGAGGCTA 57.438 47.619 10.08 0.00 0.00 3.93
2143 2172 4.046286 AGTAATGCCCCATTCAAACTGA 57.954 40.909 0.00 0.00 35.54 3.41
2225 2256 5.080337 TCTATTCGATCTTGATAGCCTGGT 58.920 41.667 0.00 0.00 0.00 4.00


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.