Multiple sequence alignment - TraesCS1D01G193400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G193400 chr1D 100.000 3963 0 0 1 3963 269414823 269418785 0.000000e+00 7319
1 TraesCS1D01G193400 chr1D 97.731 3966 83 7 1 3963 185777470 185781431 0.000000e+00 6818
2 TraesCS1D01G193400 chr4D 97.982 3965 74 5 1 3963 134990791 134986831 0.000000e+00 6874
3 TraesCS1D01G193400 chr5D 97.857 3967 80 2 1 3963 301066344 301062379 0.000000e+00 6850
4 TraesCS1D01G193400 chr5A 97.729 3963 89 1 1 3963 600271718 600267757 0.000000e+00 6818
5 TraesCS1D01G193400 chr6D 97.605 3966 91 3 1 3963 369961949 369965913 0.000000e+00 6794
6 TraesCS1D01G193400 chr7B 96.720 3963 123 2 1 3963 247485339 247481384 0.000000e+00 6591
7 TraesCS1D01G193400 chr2B 98.144 3502 55 2 462 3963 449194165 449190674 0.000000e+00 6098
8 TraesCS1D01G193400 chrUn 98.030 3502 63 1 462 3963 171052194 171055689 0.000000e+00 6080
9 TraesCS1D01G193400 chr3B 97.716 3502 74 1 462 3963 201597061 201593566 0.000000e+00 6019
10 TraesCS1D01G193400 chr3B 99.254 402 3 0 1 402 201597452 201597051 0.000000e+00 726
11 TraesCS1D01G193400 chr3B 98.756 402 5 0 1 402 6029152 6029553 0.000000e+00 715
12 TraesCS1D01G193400 chr3B 98.756 402 5 0 1 402 92315086 92315487 0.000000e+00 715
13 TraesCS1D01G193400 chr3B 97.531 81 2 0 392 472 92221389 92221309 5.340000e-29 139
14 TraesCS1D01G193400 chr3B 96.296 81 3 0 392 472 5093729 5093809 2.480000e-27 134
15 TraesCS1D01G193400 chr3B 96.296 81 3 0 392 472 92243030 92243110 2.480000e-27 134


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G193400 chr1D 269414823 269418785 3962 False 7319.0 7319 100.000 1 3963 1 chr1D.!!$F2 3962
1 TraesCS1D01G193400 chr1D 185777470 185781431 3961 False 6818.0 6818 97.731 1 3963 1 chr1D.!!$F1 3962
2 TraesCS1D01G193400 chr4D 134986831 134990791 3960 True 6874.0 6874 97.982 1 3963 1 chr4D.!!$R1 3962
3 TraesCS1D01G193400 chr5D 301062379 301066344 3965 True 6850.0 6850 97.857 1 3963 1 chr5D.!!$R1 3962
4 TraesCS1D01G193400 chr5A 600267757 600271718 3961 True 6818.0 6818 97.729 1 3963 1 chr5A.!!$R1 3962
5 TraesCS1D01G193400 chr6D 369961949 369965913 3964 False 6794.0 6794 97.605 1 3963 1 chr6D.!!$F1 3962
6 TraesCS1D01G193400 chr7B 247481384 247485339 3955 True 6591.0 6591 96.720 1 3963 1 chr7B.!!$R1 3962
7 TraesCS1D01G193400 chr2B 449190674 449194165 3491 True 6098.0 6098 98.144 462 3963 1 chr2B.!!$R1 3501
8 TraesCS1D01G193400 chrUn 171052194 171055689 3495 False 6080.0 6080 98.030 462 3963 1 chrUn.!!$F1 3501
9 TraesCS1D01G193400 chr3B 201593566 201597452 3886 True 3372.5 6019 98.485 1 3963 2 chr3B.!!$R2 3962

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
995 1068 2.289444 GGTTCGAATCCACCTCAGAACA 60.289 50.0 0.0 0.0 39.53 3.18 F
1862 1937 2.159170 GCTAGCTCTGTGGTTCGATTCT 60.159 50.0 7.7 0.0 0.00 2.40 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2583 2663 1.312371 TTGGCGATAAGCTTGTGCCC 61.312 55.0 25.98 15.45 45.12 5.36 R
3842 3926 1.352622 ACAAGGGTCTTGCTCCACCA 61.353 55.0 7.48 0.00 33.91 4.17 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
44 45 4.212716 TGACTTCTGTGTACCACTAGTGT 58.787 43.478 21.18 11.81 35.11 3.55
648 720 7.039270 TGAAATGAATGAATGAAAGCCATGAG 58.961 34.615 0.00 0.00 35.24 2.90
754 826 7.787725 ATTATTCTTTCGTAAGTCCATCCAC 57.212 36.000 1.51 0.00 39.48 4.02
892 965 4.339814 GTGTGGGTGTGAAGTGGAAAAATA 59.660 41.667 0.00 0.00 0.00 1.40
895 968 3.892588 GGGTGTGAAGTGGAAAAATACCA 59.107 43.478 0.00 0.00 34.84 3.25
995 1068 2.289444 GGTTCGAATCCACCTCAGAACA 60.289 50.000 0.00 0.00 39.53 3.18
1007 1080 6.098124 TCCACCTCAGAACAAACAATGAAAAT 59.902 34.615 0.00 0.00 0.00 1.82
1035 1108 2.586792 GGGTGCAAGCTCGAGGAT 59.413 61.111 15.58 0.00 0.00 3.24
1218 1291 6.382608 GTTCTAGCTTGATACTGCGATATCA 58.617 40.000 3.12 5.79 39.33 2.15
1288 1363 5.398012 GGCCTCCAGTAGTTTTCTATGGAAT 60.398 44.000 0.00 0.00 38.41 3.01
1357 1432 5.397360 AGACTTTCCTGAACCATCCATTTT 58.603 37.500 0.00 0.00 0.00 1.82
1441 1516 7.066645 CCAAGCAGTAAGAGAAATTCATCATGA 59.933 37.037 0.00 0.00 0.00 3.07
1581 1656 5.109210 AGAGATTTTTCATGTATCGACGCA 58.891 37.500 0.00 0.00 0.00 5.24
1619 1694 4.660789 AAGTACGTTGTACTGGACTTGT 57.339 40.909 10.15 0.00 0.00 3.16
1739 1814 3.165875 AGCAGTGTTTCCAGTCTAGCTA 58.834 45.455 0.00 0.00 0.00 3.32
1862 1937 2.159170 GCTAGCTCTGTGGTTCGATTCT 60.159 50.000 7.70 0.00 0.00 2.40
1975 2053 7.049754 AGCTTTCACAGTGGAAAATGAAAAAT 58.950 30.769 0.00 0.00 39.78 1.82
1984 2063 9.806203 CAGTGGAAAATGAAAAATAGCATATCA 57.194 29.630 0.00 0.00 0.00 2.15
2205 2285 3.873801 GCTCCAAGTAGAATTTCCAGGCA 60.874 47.826 0.00 0.00 0.00 4.75
2359 2439 3.132925 CAATCAAAAAGGGCAAGGTGTG 58.867 45.455 0.00 0.00 0.00 3.82
2731 2811 1.152383 GCGAAGGAAGTATGACCGCC 61.152 60.000 0.00 0.00 35.79 6.13
2975 3059 6.315091 TCGTAGAGTGACAAGCCTATTATC 57.685 41.667 0.00 0.00 0.00 1.75
3056 3140 4.222810 GGAATTGCTTAAACAATCCCAGGT 59.777 41.667 2.25 0.00 39.32 4.00
3079 3163 0.787084 TCCTCTCCCAGTGGAAGAGT 59.213 55.000 22.65 0.00 41.17 3.24
3335 3419 2.472695 TTCTGATTTCCCCACAGACG 57.527 50.000 0.00 0.00 39.80 4.18
3336 3420 1.639722 TCTGATTTCCCCACAGACGA 58.360 50.000 0.00 0.00 36.04 4.20
3842 3926 2.241176 TCCCCGTGCTTTATCTCCATTT 59.759 45.455 0.00 0.00 0.00 2.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
44 45 0.032615 ACCACCAAAGGCCTTTGTGA 60.033 50.000 41.82 0.00 46.19 3.58
466 468 5.709140 CGCTAACGCTTTCTTTAGTTTTG 57.291 39.130 0.00 0.00 0.00 2.44
648 720 0.833287 TCTTCCTACTGGAGGCATGC 59.167 55.000 9.90 9.90 46.25 4.06
754 826 4.959210 TCTTTCTCCTCAACCTATCTCCAG 59.041 45.833 0.00 0.00 0.00 3.86
895 968 4.809496 CCCGCTGCCAGCCAGAAT 62.809 66.667 11.83 0.00 44.64 2.40
995 1068 3.564511 CTCGACGCCATTTTCATTGTTT 58.435 40.909 0.00 0.00 0.00 2.83
1035 1108 4.366267 AGCTTTCTTCCATCCTTCCTAGA 58.634 43.478 0.00 0.00 0.00 2.43
1126 1199 2.567615 ACTAACCGATGAAGCTCAACCT 59.432 45.455 0.00 0.00 0.00 3.50
1218 1291 3.003394 TGCTCCGTTGGATGATTTGAT 57.997 42.857 0.00 0.00 0.00 2.57
1357 1432 1.304299 TGTCACGACCGTGGGGATA 60.304 57.895 20.45 0.13 45.43 2.59
1619 1694 2.756760 CACTTCTGCGTAACTAGGGGTA 59.243 50.000 0.00 0.00 0.00 3.69
1653 1728 0.252330 TGGTAAGGTCCGGTCATCCA 60.252 55.000 0.00 0.00 0.00 3.41
1739 1814 2.813754 CACTTCACACCCGATTTGACAT 59.186 45.455 0.00 0.00 0.00 3.06
1862 1937 6.852858 TCATTCATTGTTCGTTCTGTTGTA 57.147 33.333 0.00 0.00 0.00 2.41
2205 2285 5.587388 TTGAAGAGGTTCGTATACGGAAT 57.413 39.130 24.18 8.77 40.29 3.01
2359 2439 8.027189 TGACCGATAGCTACATAAACACATATC 58.973 37.037 0.00 0.00 0.00 1.63
2583 2663 1.312371 TTGGCGATAAGCTTGTGCCC 61.312 55.000 25.98 15.45 45.12 5.36
2731 2811 7.493971 CCAGATTGAGTCTCAACTATTGGTAAG 59.506 40.741 17.49 3.65 39.45 2.34
3056 3140 4.033709 CTCTTCCACTGGGAGAGGATTTA 58.966 47.826 22.24 0.00 46.01 1.40
3079 3163 9.964354 TGTTCCGGTATAAATAGTAGCTATCTA 57.036 33.333 0.00 1.14 0.00 1.98
3842 3926 1.352622 ACAAGGGTCTTGCTCCACCA 61.353 55.000 7.48 0.00 33.91 4.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.