Multiple sequence alignment - TraesCS1D01G193200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G193200 chr1D 100.000 2594 0 0 1 2594 269406767 269409360 0 4791
1 TraesCS1D01G193200 chr5A 98.806 2597 28 3 1 2594 19248879 19246283 0 4621
2 TraesCS1D01G193200 chr7D 98.766 2593 30 2 1 2591 381923966 381926558 0 4610
3 TraesCS1D01G193200 chr7D 98.689 2593 32 2 1 2591 203499964 203502556 0 4599
4 TraesCS1D01G193200 chr7D 98.689 2594 31 3 1 2591 382050043 382052636 0 4599
5 TraesCS1D01G193200 chr4D 98.342 2593 39 4 1 2591 123335438 123338028 0 4547
6 TraesCS1D01G193200 chr1A 98.305 2596 37 3 1 2594 498691262 498688672 0 4543


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G193200 chr1D 269406767 269409360 2593 False 4791 4791 100.000 1 2594 1 chr1D.!!$F1 2593
1 TraesCS1D01G193200 chr5A 19246283 19248879 2596 True 4621 4621 98.806 1 2594 1 chr5A.!!$R1 2593
2 TraesCS1D01G193200 chr7D 381923966 381926558 2592 False 4610 4610 98.766 1 2591 1 chr7D.!!$F2 2590
3 TraesCS1D01G193200 chr7D 203499964 203502556 2592 False 4599 4599 98.689 1 2591 1 chr7D.!!$F1 2590
4 TraesCS1D01G193200 chr7D 382050043 382052636 2593 False 4599 4599 98.689 1 2591 1 chr7D.!!$F3 2590
5 TraesCS1D01G193200 chr4D 123335438 123338028 2590 False 4547 4547 98.342 1 2591 1 chr4D.!!$F1 2590
6 TraesCS1D01G193200 chr1A 498688672 498691262 2590 True 4543 4543 98.305 1 2594 1 chr1A.!!$R1 2593

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
957 962 0.60864 TCTCTCGAGCCCCAAGAAAC 59.391 55.0 7.81 0.0 0.0 2.78 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1809 1814 0.997226 ATACGATCGCGCGCAGTAAG 60.997 55.0 32.61 19.33 42.48 2.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
187 188 5.745227 CTTTGCTAATCTTCCCCTCTAACA 58.255 41.667 0.00 0.00 0.00 2.41
236 237 4.058817 GGAAGAAAGAAAGTCGAAGAGCA 58.941 43.478 0.00 0.00 36.95 4.26
495 499 6.468798 GGGGATATTAGCTGGGTAAGGAAAAT 60.469 42.308 0.00 0.00 0.00 1.82
532 536 7.200778 TGAGATGTCGATTTGTTTTTCATCA 57.799 32.000 8.87 0.00 34.55 3.07
611 615 5.272283 TCTAATAAAGAATTCCGGCTCGT 57.728 39.130 0.65 0.00 0.00 4.18
957 962 0.608640 TCTCTCGAGCCCCAAGAAAC 59.391 55.000 7.81 0.00 0.00 2.78
978 983 1.454847 CCCCTCTCCCTCAGACTCG 60.455 68.421 0.00 0.00 0.00 4.18
1007 1012 9.083422 CTCTCTTTTGACTCTATATATGTGGGA 57.917 37.037 0.00 0.00 0.00 4.37
1452 1457 8.497745 ACCTTCTCCATTACAATGTTCTCATAT 58.502 33.333 0.00 0.00 34.60 1.78
1631 1636 2.193536 GGCAGTTTTCCGTGCACCT 61.194 57.895 12.15 0.00 41.75 4.00
1809 1814 4.344390 CCTTAGGTGTAATAGGACTCCCAC 59.656 50.000 0.00 0.00 34.17 4.61
1842 1847 2.430248 TCGTATACTGAGGTGCTCCA 57.570 50.000 7.70 0.00 35.89 3.86
1858 1863 0.107081 TCCACGTCGGTTGTTGGAAT 59.893 50.000 0.00 0.00 35.57 3.01
2042 2047 7.147585 CCTCCAATGAAGAAATAAGAGGAGAGA 60.148 40.741 0.00 0.00 41.82 3.10
2188 2193 1.870064 AATCAAGGATTTGGGGCTGG 58.130 50.000 0.00 0.00 34.97 4.85
2591 2596 3.987745 TGAGAGTAAGATCCTTGGCTCT 58.012 45.455 12.14 12.14 36.20 4.09
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
207 208 1.420138 ACTTTCTTTCTTCCTCCCGCA 59.580 47.619 0.00 0.00 0.00 5.69
330 334 1.441729 GTCCTAGCTACGCCATGCA 59.558 57.895 0.00 0.00 0.00 3.96
495 499 3.525537 GACATCTCAATCTCCGAAAGCA 58.474 45.455 0.00 0.00 0.00 3.91
532 536 1.547901 CCCTCGGCCTTCTTCCTTTTT 60.548 52.381 0.00 0.00 0.00 1.94
972 977 5.253330 AGAGTCAAAAGAGAGATCGAGTCT 58.747 41.667 0.00 0.00 40.81 3.24
1007 1012 5.308237 GGTGAACCCTCATAGATATCAGGTT 59.692 44.000 5.32 7.58 38.78 3.50
1045 1050 3.281727 AGGCGCAATAGAAAGGAATGA 57.718 42.857 10.83 0.00 0.00 2.57
1452 1457 0.834612 CTAACGGGGGTATTCCTGCA 59.165 55.000 0.00 0.00 36.66 4.41
1631 1636 2.488937 TGATTCGGTAAGCTACGTGTCA 59.511 45.455 0.00 7.81 0.00 3.58
1809 1814 0.997226 ATACGATCGCGCGCAGTAAG 60.997 55.000 32.61 19.33 42.48 2.34
1842 1847 1.223187 GTCATTCCAACAACCGACGT 58.777 50.000 0.00 0.00 0.00 4.34
1970 1975 1.967779 CCCAACGAAAATGGAAAGGGT 59.032 47.619 0.00 0.00 40.56 4.34
2304 2309 2.640184 CAGCAGAGCCATTTCATGAGA 58.360 47.619 0.00 0.00 0.00 3.27
2314 2319 1.035385 CATCCATTGCAGCAGAGCCA 61.035 55.000 0.00 0.00 0.00 4.75


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.