Multiple sequence alignment - TraesCS1D01G193100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G193100 chr1D 100.000 2439 0 0 1 2439 269408403 269405965 0 4505
1 TraesCS1D01G193100 chr1D 97.871 2443 43 5 1 2439 43235398 43237835 0 4215
2 TraesCS1D01G193100 chr7D 98.731 2443 27 3 1 2439 381925604 381923162 0 4337
3 TraesCS1D01G193100 chr6D 98.730 2441 29 2 1 2439 124519125 124516685 0 4335
4 TraesCS1D01G193100 chr1A 98.363 2444 31 7 1 2439 498689624 498692063 0 4283
5 TraesCS1D01G193100 chrUn 98.160 2446 38 5 1 2439 186206818 186209263 0 4261
6 TraesCS1D01G193100 chr4D 98.036 2444 41 6 1 2439 123337074 123334633 0 4241


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G193100 chr1D 269405965 269408403 2438 True 4505 4505 100.000 1 2439 1 chr1D.!!$R1 2438
1 TraesCS1D01G193100 chr1D 43235398 43237835 2437 False 4215 4215 97.871 1 2439 1 chr1D.!!$F1 2438
2 TraesCS1D01G193100 chr7D 381923162 381925604 2442 True 4337 4337 98.731 1 2439 1 chr7D.!!$R1 2438
3 TraesCS1D01G193100 chr6D 124516685 124519125 2440 True 4335 4335 98.730 1 2439 1 chr6D.!!$R1 2438
4 TraesCS1D01G193100 chr1A 498689624 498692063 2439 False 4283 4283 98.363 1 2439 1 chr1A.!!$F1 2438
5 TraesCS1D01G193100 chrUn 186206818 186209263 2445 False 4261 4261 98.160 1 2439 1 chrUn.!!$F1 2438
6 TraesCS1D01G193100 chr4D 123334633 123337074 2441 True 4241 4241 98.036 1 2439 1 chr4D.!!$R1 2438

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
184 185 0.834612 CTAACGGGGGTATTCCTGCA 59.165 55.0 0.0 0.0 36.66 4.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2082 2095 0.108138 CTTGCCCTCCAGAAGTACCG 60.108 60.0 0.0 0.0 0.0 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
184 185 0.834612 CTAACGGGGGTATTCCTGCA 59.165 55.000 0.00 0.00 36.66 4.41
591 592 3.281727 AGGCGCAATAGAAAGGAATGA 57.718 42.857 10.83 0.00 0.00 2.57
629 630 5.308237 GGTGAACCCTCATAGATATCAGGTT 59.692 44.000 5.32 7.58 38.78 3.50
664 665 5.253330 AGAGTCAAAAGAGAGATCGAGTCT 58.747 41.667 0.00 0.00 40.81 3.24
1104 1109 1.547901 CCCTCGGCCTTCTTCCTTTTT 60.548 52.381 0.00 0.00 0.00 1.94
1141 1146 3.525537 GACATCTCAATCTCCGAAAGCA 58.474 45.455 0.00 0.00 0.00 3.91
1306 1311 1.441729 GTCCTAGCTACGCCATGCA 59.558 57.895 0.00 0.00 0.00 3.96
1429 1435 1.420138 ACTTTCTTTCTTCCTCCCGCA 59.580 47.619 0.00 0.00 0.00 5.69
2009 2022 8.893727 GGCTTCATAGCTACTTTCATTCTAAAA 58.106 33.333 0.00 0.00 46.90 1.52
2207 2220 2.846193 AGCGAAAGTTGTAGAAAGCCA 58.154 42.857 0.00 0.00 0.00 4.75
2432 2445 6.947464 ACAAAGCTAAGAAGTAGGCTGAATA 58.053 36.000 0.00 0.00 35.08 1.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
5 6 2.193536 GGCAGTTTTCCGTGCACCT 61.194 57.895 12.15 0.0 41.75 4.00
184 185 8.497745 ACCTTCTCCATTACAATGTTCTCATAT 58.502 33.333 0.00 0.0 34.60 1.78
629 630 9.083422 CTCTCTTTTGACTCTATATATGTGGGA 57.917 37.037 0.00 0.0 0.00 4.37
658 659 1.454847 CCCCTCTCCCTCAGACTCG 60.455 68.421 0.00 0.0 0.00 4.18
1025 1030 5.272283 TCTAATAAAGAATTCCGGCTCGT 57.728 39.130 0.65 0.0 0.00 4.18
1104 1109 7.200778 TGAGATGTCGATTTGTTTTTCATCA 57.799 32.000 8.87 0.0 34.55 3.07
1141 1146 6.468798 GGGGATATTAGCTGGGTAAGGAAAAT 60.469 42.308 0.00 0.0 0.00 1.82
1400 1406 4.058817 GGAAGAAAGAAAGTCGAAGAGCA 58.941 43.478 0.00 0.0 36.95 4.26
1449 1455 5.745227 CTTTGCTAATCTTCCCCTCTAACA 58.255 41.667 0.00 0.0 0.00 2.41
2009 2022 5.176958 GCCTGCGTATTGACTAATATTCGTT 59.823 40.000 0.00 0.0 31.81 3.85
2027 2040 0.723981 GCTACTGAAAGAAGCCTGCG 59.276 55.000 0.00 0.0 37.43 5.18
2082 2095 0.108138 CTTGCCCTCCAGAAGTACCG 60.108 60.000 0.00 0.0 0.00 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.