Multiple sequence alignment - TraesCS1D01G183900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G183900 chr1D 100.000 2237 0 0 1 2237 254531613 254533849 0.000000e+00 4132
1 TraesCS1D01G183900 chr7B 98.570 2238 30 2 1 2237 662732929 662735165 0.000000e+00 3954
2 TraesCS1D01G183900 chr7B 98.553 1590 22 1 1 1589 622431953 622430364 0.000000e+00 2808
3 TraesCS1D01G183900 chr3A 98.302 2238 36 2 1 2237 672883013 672880777 0.000000e+00 3921
4 TraesCS1D01G183900 chr3A 98.231 2205 38 1 1 2204 695636415 695638619 0.000000e+00 3855
5 TraesCS1D01G183900 chr3B 98.257 2238 38 1 1 2237 201565366 201563129 0.000000e+00 3916
6 TraesCS1D01G183900 chr3B 92.140 229 16 1 1999 2227 143541644 143541418 2.770000e-84 322
7 TraesCS1D01G183900 chr3B 92.818 181 7 2 1703 1883 169829422 169829596 7.930000e-65 257
8 TraesCS1D01G183900 chr3B 91.176 170 13 2 1573 1742 531003503 531003670 1.730000e-56 230
9 TraesCS1D01G183900 chr1B 97.945 2238 44 2 1 2237 633733455 633731219 0.000000e+00 3877
10 TraesCS1D01G183900 chr6B 97.280 2243 39 11 1 2237 615601575 615599349 0.000000e+00 3784
11 TraesCS1D01G183900 chr2A 98.708 2090 26 1 1 2089 543187676 543189765 0.000000e+00 3709
12 TraesCS1D01G183900 chr7A 94.813 1793 81 8 449 2237 352681572 352679788 0.000000e+00 2785


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G183900 chr1D 254531613 254533849 2236 False 4132 4132 100.000 1 2237 1 chr1D.!!$F1 2236
1 TraesCS1D01G183900 chr7B 662732929 662735165 2236 False 3954 3954 98.570 1 2237 1 chr7B.!!$F1 2236
2 TraesCS1D01G183900 chr7B 622430364 622431953 1589 True 2808 2808 98.553 1 1589 1 chr7B.!!$R1 1588
3 TraesCS1D01G183900 chr3A 672880777 672883013 2236 True 3921 3921 98.302 1 2237 1 chr3A.!!$R1 2236
4 TraesCS1D01G183900 chr3A 695636415 695638619 2204 False 3855 3855 98.231 1 2204 1 chr3A.!!$F1 2203
5 TraesCS1D01G183900 chr3B 201563129 201565366 2237 True 3916 3916 98.257 1 2237 1 chr3B.!!$R2 2236
6 TraesCS1D01G183900 chr1B 633731219 633733455 2236 True 3877 3877 97.945 1 2237 1 chr1B.!!$R1 2236
7 TraesCS1D01G183900 chr6B 615599349 615601575 2226 True 3784 3784 97.280 1 2237 1 chr6B.!!$R1 2236
8 TraesCS1D01G183900 chr2A 543187676 543189765 2089 False 3709 3709 98.708 1 2089 1 chr2A.!!$F1 2088
9 TraesCS1D01G183900 chr7A 352679788 352681572 1784 True 2785 2785 94.813 449 2237 1 chr7A.!!$R1 1788

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
163 164 2.817258 AGCGATTTTCGAACCATTTCCA 59.183 40.909 0.0 0.0 43.74 3.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2041 2050 1.13456 GAAGCTCGTAACATCGGTCCT 59.865 52.381 0.0 0.0 0.0 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
163 164 2.817258 AGCGATTTTCGAACCATTTCCA 59.183 40.909 0.0 0.0 43.74 3.53
1873 1882 0.752009 TTCGCATCGGAGGAGTAGCT 60.752 55.000 0.0 0.0 0.00 3.32
2041 2050 4.249638 AGCAGTAAATTGGGGCTTATCA 57.750 40.909 0.0 0.0 0.00 2.15
2167 2176 3.184581 GGGATTCGTTAGCTCGCTATTTG 59.815 47.826 0.0 0.0 0.00 2.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
72 73 5.477637 TGCATTTCAGTCAAATTCAGATCCA 59.522 36.000 0.00 0.00 31.79 3.41
322 323 7.607991 ACATGAAAATTCTCAATTCTCTACGGT 59.392 33.333 0.00 0.00 0.00 4.83
429 430 3.420893 TGGCCTGATTTCGAAATTGTCT 58.579 40.909 23.49 2.52 0.00 3.41
1129 1133 4.818005 ACGTTTTCCCAAAAGTCTTCGTAT 59.182 37.500 0.00 0.00 29.59 3.06
1873 1882 2.567169 CCATCCATAAGGTAGATCGGCA 59.433 50.000 0.00 0.00 35.89 5.69
2041 2050 1.134560 GAAGCTCGTAACATCGGTCCT 59.865 52.381 0.00 0.00 0.00 3.85
2167 2176 3.377172 CCCTCATTTCACCAATTCGTACC 59.623 47.826 0.00 0.00 0.00 3.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.