Multiple sequence alignment - TraesCS1D01G183800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G183800 chr1D 100.000 2201 0 0 1 2201 254530932 254528732 0 4065
1 TraesCS1D01G183800 chr2A 98.864 2201 25 0 1 2201 726901129 726903329 0 3927
2 TraesCS1D01G183800 chr3B 98.546 2201 32 0 1 2201 201569461 201571661 0 3888
3 TraesCS1D01G183800 chr7B 98.455 2201 33 1 1 2201 662732239 662730040 0 3875
4 TraesCS1D01G183800 chr7B 98.364 2201 35 1 1 2201 663094100 663096299 0 3864
5 TraesCS1D01G183800 chr5D 98.410 2201 34 1 1 2201 503250596 503248397 0 3869
6 TraesCS1D01G183800 chr3D 98.410 2201 34 1 1 2201 589258202 589260401 0 3869
7 TraesCS1D01G183800 chr6B 98.274 2201 38 0 1 2201 450085128 450082928 0 3855
8 TraesCS1D01G183800 chr2D 98.228 2201 35 4 1 2201 272806924 272809120 0 3845


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G183800 chr1D 254528732 254530932 2200 True 4065 4065 100.000 1 2201 1 chr1D.!!$R1 2200
1 TraesCS1D01G183800 chr2A 726901129 726903329 2200 False 3927 3927 98.864 1 2201 1 chr2A.!!$F1 2200
2 TraesCS1D01G183800 chr3B 201569461 201571661 2200 False 3888 3888 98.546 1 2201 1 chr3B.!!$F1 2200
3 TraesCS1D01G183800 chr7B 662730040 662732239 2199 True 3875 3875 98.455 1 2201 1 chr7B.!!$R1 2200
4 TraesCS1D01G183800 chr7B 663094100 663096299 2199 False 3864 3864 98.364 1 2201 1 chr7B.!!$F1 2200
5 TraesCS1D01G183800 chr5D 503248397 503250596 2199 True 3869 3869 98.410 1 2201 1 chr5D.!!$R1 2200
6 TraesCS1D01G183800 chr3D 589258202 589260401 2199 False 3869 3869 98.410 1 2201 1 chr3D.!!$F1 2200
7 TraesCS1D01G183800 chr6B 450082928 450085128 2200 True 3855 3855 98.274 1 2201 1 chr6B.!!$R1 2200
8 TraesCS1D01G183800 chr2D 272806924 272809120 2196 False 3845 3845 98.228 1 2201 1 chr2D.!!$F1 2200

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
613 614 2.362077 CCAAATTCGGGATGGATTGGTC 59.638 50.0 0.0 0.0 36.27 4.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1971 1974 0.03601 CTGATGACAAGGAAGCCGGT 60.036 55.0 1.9 0.0 0.0 5.28 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
613 614 2.362077 CCAAATTCGGGATGGATTGGTC 59.638 50.000 0.00 0.00 36.27 4.02
988 989 6.978674 ATCCTATTTCCATACTTCTGTCGA 57.021 37.500 0.00 0.00 0.00 4.20
1271 1272 2.364002 TGTCTCATGACGTTCTGAACCA 59.636 45.455 14.48 8.25 45.70 3.67
1273 1274 3.807622 GTCTCATGACGTTCTGAACCAAA 59.192 43.478 14.48 1.06 33.15 3.28
1419 1420 5.599242 AGCCTGTTATCCCTAGAGTAACTTC 59.401 44.000 0.00 0.00 31.37 3.01
1432 1433 4.705507 AGAGTAACTTCTATCCGTTGAGCA 59.294 41.667 0.00 0.00 0.00 4.26
1532 1534 0.538057 CCCTTCTGCCTTTGCACTCA 60.538 55.000 0.00 0.00 44.23 3.41
1545 1547 1.421268 TGCACTCAAGGACCAATGTCT 59.579 47.619 0.00 0.00 41.47 3.41
1739 1742 1.640917 TCTTCGCCTTCCACCTAAGT 58.359 50.000 0.00 0.00 0.00 2.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
613 614 1.033574 CCTAGGCGTAGAGGAACCAG 58.966 60.000 14.94 0.00 34.46 4.00
857 858 4.083484 CGATTTGAACCTTGTTCCTACACC 60.083 45.833 4.65 0.00 32.98 4.16
1271 1272 4.698304 CCCATTAATGTGGTACGTGAGTTT 59.302 41.667 14.25 0.00 38.32 2.66
1273 1274 3.869065 CCCATTAATGTGGTACGTGAGT 58.131 45.455 14.25 0.00 41.45 3.41
1432 1433 4.016706 CCGAGTGGAAGGGCCGTT 62.017 66.667 11.21 11.21 40.66 4.44
1532 1534 1.271597 GCCAGACAGACATTGGTCCTT 60.272 52.381 0.00 0.00 45.48 3.36
1545 1547 2.747686 GTTTCCTCGGGCCAGACA 59.252 61.111 4.39 0.00 0.00 3.41
1739 1742 4.594854 TGGGCCTTTCCTGCGCAA 62.595 61.111 13.05 0.00 46.85 4.85
1971 1974 0.036010 CTGATGACAAGGAAGCCGGT 60.036 55.000 1.90 0.00 0.00 5.28
1981 1984 3.882888 GGAAGTTGGTGAACTGATGACAA 59.117 43.478 0.00 0.00 41.87 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.