Multiple sequence alignment - TraesCS1D01G183700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G183700 chr1D 100.000 2240 0 0 1 2240 254528099 254530338 0 4137
1 TraesCS1D01G183700 chr2A 98.527 2240 33 0 1 2240 726903962 726901723 0 3954
2 TraesCS1D01G183700 chr5D 98.170 2240 39 2 1 2240 503247765 503250002 0 3908
3 TraesCS1D01G183700 chr5D 97.948 2242 41 4 1 2240 503262283 503260045 0 3880
4 TraesCS1D01G183700 chr3D 98.170 2240 40 1 1 2240 589261034 589258796 0 3908
5 TraesCS1D01G183700 chr3B 98.036 2240 44 0 1 2240 201572294 201570055 0 3893
6 TraesCS1D01G183700 chr2D 97.991 2240 41 4 1 2240 272809753 272807518 0 3884
7 TraesCS1D01G183700 chr7B 97.902 2240 46 1 1 2240 662729407 662731645 0 3875
8 TraesCS1D01G183700 chr7B 97.857 2240 47 1 1 2240 663096932 663094694 0 3869
9 TraesCS1D01G183700 chr3A 97.723 2240 49 2 1 2240 695642878 695645115 0 3853


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G183700 chr1D 254528099 254530338 2239 False 4137 4137 100.000 1 2240 1 chr1D.!!$F1 2239
1 TraesCS1D01G183700 chr2A 726901723 726903962 2239 True 3954 3954 98.527 1 2240 1 chr2A.!!$R1 2239
2 TraesCS1D01G183700 chr5D 503247765 503250002 2237 False 3908 3908 98.170 1 2240 1 chr5D.!!$F1 2239
3 TraesCS1D01G183700 chr5D 503260045 503262283 2238 True 3880 3880 97.948 1 2240 1 chr5D.!!$R1 2239
4 TraesCS1D01G183700 chr3D 589258796 589261034 2238 True 3908 3908 98.170 1 2240 1 chr3D.!!$R1 2239
5 TraesCS1D01G183700 chr3B 201570055 201572294 2239 True 3893 3893 98.036 1 2240 1 chr3B.!!$R1 2239
6 TraesCS1D01G183700 chr2D 272807518 272809753 2235 True 3884 3884 97.991 1 2240 1 chr2D.!!$R1 2239
7 TraesCS1D01G183700 chr7B 662729407 662731645 2238 False 3875 3875 97.902 1 2240 1 chr7B.!!$F1 2239
8 TraesCS1D01G183700 chr7B 663094694 663096932 2238 True 3869 3869 97.857 1 2240 1 chr7B.!!$R1 2239
9 TraesCS1D01G183700 chr3A 695642878 695645115 2237 False 3853 3853 97.723 1 2240 1 chr3A.!!$F1 2239

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
862 863 0.03601 CTGATGACAAGGAAGCCGGT 60.036 55.0 1.9 0.0 0.0 5.28 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1845 1847 6.978674 ATCCTATTTCCATACTTCTGTCGA 57.021 37.5 0.0 0.0 0.0 4.2 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
35 36 3.304123 GCGTAATAGCTCACTGATCGAGT 60.304 47.826 0.00 0.00 34.02 4.18
85 86 1.219124 GATCTGCCGAAGCTGTGGA 59.781 57.895 8.63 0.00 40.80 4.02
91 92 1.648467 GCCGAAGCTGTGGAATGTCC 61.648 60.000 8.63 0.00 34.52 4.02
185 186 3.375299 GCAAGAATGTCGGCTTGAGTAAT 59.625 43.478 0.00 0.00 43.11 1.89
303 304 1.670674 GGCGTAGTCGATGGACAACAA 60.671 52.381 10.69 0.00 45.92 2.83
371 372 1.867865 GCTAGGTTAGCCGAAAGATGC 59.132 52.381 0.00 0.00 45.95 3.91
852 853 3.882888 GGAAGTTGGTGAACTGATGACAA 59.117 43.478 0.00 0.00 41.87 3.18
862 863 0.036010 CTGATGACAAGGAAGCCGGT 60.036 55.000 1.90 0.00 0.00 5.28
1094 1095 4.594854 TGGGCCTTTCCTGCGCAA 62.595 61.111 13.05 0.00 46.85 4.85
1288 1289 2.747686 GTTTCCTCGGGCCAGACA 59.252 61.111 4.39 0.00 0.00 3.41
1301 1302 1.271597 GCCAGACAGACATTGGTCCTT 60.272 52.381 0.00 0.00 45.48 3.36
1401 1403 4.016706 CCGAGTGGAAGGGCCGTT 62.017 66.667 11.21 11.21 40.66 4.44
1560 1562 3.869065 CCCATTAATGTGGTACGTGAGT 58.131 45.455 14.25 0.00 41.45 3.41
1562 1564 4.698304 CCCATTAATGTGGTACGTGAGTTT 59.302 41.667 14.25 0.00 38.32 2.66
1576 1578 2.933906 GTGAGTTTGGTTCAGAACGTCA 59.066 45.455 7.22 0.00 0.00 4.35
1976 1978 4.083484 CGATTTGAACCTTGTTCCTACACC 60.083 45.833 4.65 0.00 32.98 4.16
2220 2224 1.033574 CCTAGGCGTAGAGGAACCAG 58.966 60.000 14.94 0.00 34.46 4.00
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
35 36 2.042259 CATCTTCAGCGCAAGGGCA 61.042 57.895 11.47 0.00 41.24 5.36
85 86 2.951642 CCTACCGATGCATTTGGACATT 59.048 45.455 21.78 5.69 32.48 2.71
91 92 1.597742 CTCCCCTACCGATGCATTTG 58.402 55.000 0.00 0.00 0.00 2.32
303 304 8.017251 ACAAGGGGTAGTATAGGAATATTGACT 58.983 37.037 0.00 0.00 0.00 3.41
371 372 7.333672 GTCACCTTGTGTCCTTAAACCTATAAG 59.666 40.741 0.00 0.00 34.79 1.73
1094 1095 1.640917 TCTTCGCCTTCCACCTAAGT 58.359 50.000 0.00 0.00 0.00 2.24
1288 1289 1.421268 TGCACTCAAGGACCAATGTCT 59.579 47.619 0.00 0.00 41.47 3.41
1301 1302 0.538057 CCCTTCTGCCTTTGCACTCA 60.538 55.000 0.00 0.00 44.23 3.41
1401 1403 4.705507 AGAGTAACTTCTATCCGTTGAGCA 59.294 41.667 0.00 0.00 0.00 4.26
1414 1416 5.599242 AGCCTGTTATCCCTAGAGTAACTTC 59.401 44.000 0.00 0.00 31.37 3.01
1560 1562 3.807622 GTCTCATGACGTTCTGAACCAAA 59.192 43.478 14.48 1.06 33.15 3.28
1562 1564 2.364002 TGTCTCATGACGTTCTGAACCA 59.636 45.455 14.48 8.25 45.70 3.67
1576 1578 3.322254 GGATATGGACCGAACTGTCTCAT 59.678 47.826 0.00 0.00 35.54 2.90
1845 1847 6.978674 ATCCTATTTCCATACTTCTGTCGA 57.021 37.500 0.00 0.00 0.00 4.20


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.