Multiple sequence alignment - TraesCS1D01G183600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G183600 chr1D 100.000 2372 0 0 1 2372 254525803 254528174 0.000000e+00 4381.0
1 TraesCS1D01G183600 chr3A 98.778 2373 26 2 1 2372 66004935 66002565 0.000000e+00 4218.0
2 TraesCS1D01G183600 chr6D 98.609 2373 30 2 1 2372 389245624 389243254 0.000000e+00 4196.0
3 TraesCS1D01G183600 chr5D 98.609 2373 30 2 1 2372 503245470 503247840 0.000000e+00 4196.0
4 TraesCS1D01G183600 chr5D 98.609 2373 30 2 1 2372 503264578 503262208 0.000000e+00 4196.0
5 TraesCS1D01G183600 chr2D 98.609 2373 30 2 1 2372 591984807 591987177 0.000000e+00 4196.0
6 TraesCS1D01G183600 chr2A 98.567 2373 31 2 1 2372 726906257 726903887 0.000000e+00 4191.0
7 TraesCS1D01G183600 chr3D 98.525 2373 31 3 1 2372 589263328 589260959 0.000000e+00 4185.0
8 TraesCS1D01G183600 chr3B 98.229 2372 39 2 1 2372 201539720 201542088 0.000000e+00 4145.0
9 TraesCS1D01G183600 chr3B 98.309 1419 21 2 1 1418 201615154 201616570 0.000000e+00 2484.0
10 TraesCS1D01G183600 chr3B 98.677 378 5 0 1995 2372 201572596 201572219 0.000000e+00 671.0
11 TraesCS1D01G183600 chr3B 98.000 250 5 0 1791 2040 161069367 161069616 3.620000e-118 435.0
12 TraesCS1D01G183600 chr3B 96.610 118 4 0 1662 1779 636831488 636831605 1.860000e-46 196.0
13 TraesCS1D01G183600 chr3B 81.443 97 18 0 1604 1700 92243852 92243948 1.950000e-11 80.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G183600 chr1D 254525803 254528174 2371 False 4381 4381 100.000 1 2372 1 chr1D.!!$F1 2371
1 TraesCS1D01G183600 chr3A 66002565 66004935 2370 True 4218 4218 98.778 1 2372 1 chr3A.!!$R1 2371
2 TraesCS1D01G183600 chr6D 389243254 389245624 2370 True 4196 4196 98.609 1 2372 1 chr6D.!!$R1 2371
3 TraesCS1D01G183600 chr5D 503245470 503247840 2370 False 4196 4196 98.609 1 2372 1 chr5D.!!$F1 2371
4 TraesCS1D01G183600 chr5D 503262208 503264578 2370 True 4196 4196 98.609 1 2372 1 chr5D.!!$R1 2371
5 TraesCS1D01G183600 chr2D 591984807 591987177 2370 False 4196 4196 98.609 1 2372 1 chr2D.!!$F1 2371
6 TraesCS1D01G183600 chr2A 726903887 726906257 2370 True 4191 4191 98.567 1 2372 1 chr2A.!!$R1 2371
7 TraesCS1D01G183600 chr3D 589260959 589263328 2369 True 4185 4185 98.525 1 2372 1 chr3D.!!$R1 2371
8 TraesCS1D01G183600 chr3B 201539720 201542088 2368 False 4145 4145 98.229 1 2372 1 chr3B.!!$F3 2371
9 TraesCS1D01G183600 chr3B 201615154 201616570 1416 False 2484 2484 98.309 1 1418 1 chr3B.!!$F4 1417

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
980 982 2.696893 GGGGAGGCCTGAGAGGTA 59.303 66.667 12.0 0.0 37.8 3.08 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2331 2333 2.042259 CATCTTCAGCGCAAGGGCA 61.042 57.895 11.47 0.0 41.24 5.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
312 313 2.906389 AGAGGACTGAAACATGCCACTA 59.094 45.455 0.00 0.0 0.00 2.74
446 447 3.064412 TCTCCTAGGCTTCCCTCATCTA 58.936 50.000 2.96 0.0 41.75 1.98
979 981 4.787280 CGGGGAGGCCTGAGAGGT 62.787 72.222 12.00 0.0 37.80 3.85
980 982 2.696893 GGGGAGGCCTGAGAGGTA 59.303 66.667 12.00 0.0 37.80 3.08
1085 1087 2.805099 GCACCGAATTTTGCCAATTCAA 59.195 40.909 15.26 0.0 36.66 2.69
1167 1169 4.603610 ACCTTAGGATGGCATAGCCTTAAT 59.396 41.667 12.47 0.0 44.62 1.40
1533 1535 3.379452 AGATGGCTAAAGTCCAGTAGCT 58.621 45.455 0.00 0.0 42.02 3.32
1686 1688 1.133606 GGTGAAAAGAACCCCCAGTGA 60.134 52.381 0.00 0.0 0.00 3.41
1875 1877 1.357137 TGTCACTGCTTATGGACCCA 58.643 50.000 0.00 0.0 0.00 4.51
1881 1883 2.916934 ACTGCTTATGGACCCAAACCTA 59.083 45.455 0.00 0.0 0.00 3.08
2073 2075 4.717279 TCTAGGGGTAAAGCACTGTTTT 57.283 40.909 0.00 0.0 0.00 2.43
2331 2333 3.304123 GCGTAATAGCTCACTGATCGAGT 60.304 47.826 0.00 0.0 34.02 4.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
203 204 3.706600 TTAGACAGCCAACCCGTAATT 57.293 42.857 0.00 0.00 0.00 1.40
312 313 9.050601 CATCTTTTTGTCTCAGTAGAGTCTTTT 57.949 33.333 0.00 0.00 42.66 2.27
446 447 1.238896 TCCTCTTCCCCAGGGATCCT 61.239 60.000 12.58 0.00 44.74 3.24
979 981 0.322322 CGCCACAGGGTAAACCACTA 59.678 55.000 0.81 0.00 43.89 2.74
980 982 1.072505 CGCCACAGGGTAAACCACT 59.927 57.895 0.81 0.00 43.89 4.00
1037 1039 5.293814 TCGCTATCATAGTATCCGCTAAGTC 59.706 44.000 0.00 0.00 0.00 3.01
1085 1087 7.765819 TGAATGTGAAATCATAGATCGAACTGT 59.234 33.333 5.31 0.00 0.00 3.55
1167 1169 4.138290 TCTTTTGAACCTCGCCATTAACA 58.862 39.130 0.00 0.00 0.00 2.41
1258 1260 6.073447 TCTATGCTTATTTTCAACTCCCCA 57.927 37.500 0.00 0.00 0.00 4.96
1686 1688 5.632347 CGGTTTCACGTTCTATTTCACTACT 59.368 40.000 0.00 0.00 0.00 2.57
1875 1877 5.308237 GGTCATGGATAGATCACCTAGGTTT 59.692 44.000 13.15 2.13 0.00 3.27
1881 1883 3.116590 TCCTGGTCATGGATAGATCACCT 60.117 47.826 0.00 0.00 0.00 4.00
1943 1945 4.264253 TCATCCGCTGATTCTTCAACATT 58.736 39.130 0.00 0.00 0.00 2.71
2331 2333 2.042259 CATCTTCAGCGCAAGGGCA 61.042 57.895 11.47 0.00 41.24 5.36


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.