Multiple sequence alignment - TraesCS1D01G183500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G183500 chr1D 100.000 2306 0 0 1 2306 254524154 254526459 0 4222
1 TraesCS1D01G183500 chr1D 98.753 481 5 1 1 480 290507546 290508026 0 854
2 TraesCS1D01G183500 chr3D 99.118 1815 14 1 492 2306 589264486 589262674 0 3262
3 TraesCS1D01G183500 chr6D 98.844 1817 17 2 492 2306 389246784 389244970 0 3236
4 TraesCS1D01G183500 chr6D 99.379 483 1 1 1 481 168249621 168250103 0 874
5 TraesCS1D01G183500 chr2D 98.844 1817 17 2 492 2306 591983647 591985461 0 3236
6 TraesCS1D01G183500 chr2D 99.378 482 2 1 1 481 272795812 272795331 0 872
7 TraesCS1D01G183500 chr3A 98.789 1816 19 2 492 2306 66006094 66004281 0 3229
8 TraesCS1D01G183500 chr3A 98.137 483 7 1 1 481 672911928 672911446 0 841
9 TraesCS1D01G183500 chr7B 98.734 1817 19 2 492 2306 663100387 663098573 0 3225
10 TraesCS1D01G183500 chr7B 98.624 1817 21 2 492 2306 662725442 662727256 0 3214
11 TraesCS1D01G183500 chr5D 98.734 1817 19 2 492 2306 503244310 503246124 0 3225
12 TraesCS1D01G183500 chr5D 99.378 482 2 1 1 481 329122025 329121544 0 872
13 TraesCS1D01G183500 chr5D 98.755 482 5 1 1 481 503216300 503216781 0 856
14 TraesCS1D01G183500 chr7D 98.733 1816 20 2 492 2306 231555387 231553574 0 3223
15 TraesCS1D01G183500 chr7D 98.965 483 3 1 1 481 231546673 231547155 0 863
16 TraesCS1D01G183500 chr2A 98.679 1817 20 2 492 2306 726907417 726905603 0 3219
17 TraesCS1D01G183500 chr2A 99.364 472 1 1 1 470 726910954 726910483 0 854
18 TraesCS1D01G183500 chrUn 99.379 483 1 1 1 481 93411550 93411068 0 874
19 TraesCS1D01G183500 chr3B 98.133 482 7 2 1 481 201525106 201525586 0 839


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G183500 chr1D 254524154 254526459 2305 False 4222.0 4222 100.0000 1 2306 1 chr1D.!!$F1 2305
1 TraesCS1D01G183500 chr3D 589262674 589264486 1812 True 3262.0 3262 99.1180 492 2306 1 chr3D.!!$R1 1814
2 TraesCS1D01G183500 chr6D 389244970 389246784 1814 True 3236.0 3236 98.8440 492 2306 1 chr6D.!!$R1 1814
3 TraesCS1D01G183500 chr2D 591983647 591985461 1814 False 3236.0 3236 98.8440 492 2306 1 chr2D.!!$F1 1814
4 TraesCS1D01G183500 chr3A 66004281 66006094 1813 True 3229.0 3229 98.7890 492 2306 1 chr3A.!!$R1 1814
5 TraesCS1D01G183500 chr7B 663098573 663100387 1814 True 3225.0 3225 98.7340 492 2306 1 chr7B.!!$R1 1814
6 TraesCS1D01G183500 chr7B 662725442 662727256 1814 False 3214.0 3214 98.6240 492 2306 1 chr7B.!!$F1 1814
7 TraesCS1D01G183500 chr5D 503244310 503246124 1814 False 3225.0 3225 98.7340 492 2306 1 chr5D.!!$F2 1814
8 TraesCS1D01G183500 chr7D 231553574 231555387 1813 True 3223.0 3223 98.7330 492 2306 1 chr7D.!!$R1 1814
9 TraesCS1D01G183500 chr2A 726905603 726910954 5351 True 2036.5 3219 99.0215 1 2306 2 chr2A.!!$R1 2305

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
471 474 1.660242 TTCCCCGCCTACCTTTACTT 58.34 50.0 0.0 0.0 0.0 2.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2095 5146 1.238896 TCCTCTTCCCCAGGGATCCT 61.239 60.0 12.58 0.0 44.74 3.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
343 346 6.201044 TGCTTTGAAAACTCTCTCGAACTTAG 59.799 38.462 0.00 0.00 0.00 2.18
470 473 1.889174 ATTCCCCGCCTACCTTTACT 58.111 50.000 0.00 0.00 0.00 2.24
471 474 1.660242 TTCCCCGCCTACCTTTACTT 58.340 50.000 0.00 0.00 0.00 2.24
472 475 1.660242 TCCCCGCCTACCTTTACTTT 58.340 50.000 0.00 0.00 0.00 2.66
473 476 2.831565 TCCCCGCCTACCTTTACTTTA 58.168 47.619 0.00 0.00 0.00 1.85
474 477 3.387012 TCCCCGCCTACCTTTACTTTAT 58.613 45.455 0.00 0.00 0.00 1.40
475 478 3.781965 TCCCCGCCTACCTTTACTTTATT 59.218 43.478 0.00 0.00 0.00 1.40
476 479 4.227982 TCCCCGCCTACCTTTACTTTATTT 59.772 41.667 0.00 0.00 0.00 1.40
477 480 4.951715 CCCCGCCTACCTTTACTTTATTTT 59.048 41.667 0.00 0.00 0.00 1.82
478 481 5.163591 CCCCGCCTACCTTTACTTTATTTTG 60.164 44.000 0.00 0.00 0.00 2.44
479 482 5.648960 CCCGCCTACCTTTACTTTATTTTGA 59.351 40.000 0.00 0.00 0.00 2.69
480 483 6.151480 CCCGCCTACCTTTACTTTATTTTGAA 59.849 38.462 0.00 0.00 0.00 2.69
663 3710 7.020827 ACTTGGATATGGAAGTCTTCTTTCA 57.979 36.000 12.31 2.81 42.55 2.69
1004 4051 1.005805 TCCAAGGCACATTAGCATGGT 59.994 47.619 1.62 1.62 41.25 3.55
1083 4130 1.987807 ATGGGGCGATTCAGGTGAGG 61.988 60.000 0.00 0.00 0.00 3.86
1180 4231 4.901849 TCTCGAGAATCCATACATCCCTTT 59.098 41.667 14.01 0.00 0.00 3.11
1515 4566 5.930569 GTCTCTTAACGCCTTCCTTTTTCTA 59.069 40.000 0.00 0.00 0.00 2.10
1797 4848 0.108186 TGCATACTCCACTTGGCTCG 60.108 55.000 0.00 0.00 34.44 5.03
1798 4849 0.811616 GCATACTCCACTTGGCTCGG 60.812 60.000 0.00 0.00 34.44 4.63
1961 5012 2.906389 AGAGGACTGAAACATGCCACTA 59.094 45.455 0.00 0.00 0.00 2.74
2095 5146 3.064412 TCTCCTAGGCTTCCCTCATCTA 58.936 50.000 2.96 0.00 41.75 1.98
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
343 346 1.475682 AGTTCCAACCGATCGTCTACC 59.524 52.381 15.09 0.0 0.00 3.18
663 3710 5.014228 AGCTTGGTCTTACTTCACCCTAAAT 59.986 40.000 0.00 0.0 0.00 1.40
1004 4051 3.056107 CCGATTCAAACAGGAGGAGTACA 60.056 47.826 0.00 0.0 0.00 2.90
1083 4130 9.699703 GAATAGAAAGTTAGATCTACATGGGAC 57.300 37.037 0.67 0.0 31.35 4.46
1421 4472 5.105187 GCTCTGCTCCCATTTAAGGAAAAAT 60.105 40.000 0.00 0.0 31.49 1.82
1515 4566 2.201830 TGGGAAATAACTCCGATGGGT 58.798 47.619 0.00 0.0 36.21 4.51
1852 4903 3.706600 TTAGACAGCCAACCCGTAATT 57.293 42.857 0.00 0.0 0.00 1.40
1910 4961 4.164843 ACTTAGAAAAAGTGAGCCACCA 57.835 40.909 2.18 0.0 34.49 4.17
1961 5012 9.050601 CATCTTTTTGTCTCAGTAGAGTCTTTT 57.949 33.333 0.00 0.0 42.66 2.27
2095 5146 1.238896 TCCTCTTCCCCAGGGATCCT 61.239 60.000 12.58 0.0 44.74 3.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.