Multiple sequence alignment - TraesCS1D01G183200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G183200 chr1D 100.000 2372 0 0 1 2372 254522656 254520285 0 4381
1 TraesCS1D01G183200 chr5D 98.667 1575 18 3 1 1573 560881399 560879826 0 2789
2 TraesCS1D01G183200 chr5D 98.159 1575 23 4 1 1573 503214805 503213235 0 2743
3 TraesCS1D01G183200 chrUn 98.416 1578 19 4 1 1573 93415414 93416990 0 2771
4 TraesCS1D01G183200 chrUn 98.430 1083 14 3 1 1081 93413046 93414127 0 1903
5 TraesCS1D01G183200 chr6D 98.285 1574 17 3 1 1572 168248126 168246561 0 2748
6 TraesCS1D01G183200 chr6D 99.126 801 7 0 1572 2372 229453809 229454609 0 1441
7 TraesCS1D01G183200 chr6D 99.125 800 6 1 1574 2372 24415778 24416577 0 1437
8 TraesCS1D01G183200 chr2D 97.968 1575 25 7 1 1573 272797307 272798876 0 2724
9 TraesCS1D01G183200 chr2D 98.468 1240 15 4 1 1237 635585966 635587204 0 2182
10 TraesCS1D01G183200 chr2D 99.500 800 3 1 1574 2372 190385691 190386490 0 1454
11 TraesCS1D01G183200 chr2D 99.374 799 5 0 1574 2372 295184111 295183313 0 1448
12 TraesCS1D01G183200 chr2D 99.250 800 5 1 1574 2372 190377520 190378319 0 1443
13 TraesCS1D01G183200 chr2D 99.249 799 6 0 1574 2372 461751966 461751168 0 1443
14 TraesCS1D01G183200 chr3B 97.711 1573 26 4 1 1571 201523597 201522033 0 2697
15 TraesCS1D01G183200 chr1A 97.642 1569 26 3 1 1569 584780031 584778474 0 2682
16 TraesCS1D01G183200 chr3A 97.205 1574 33 6 1 1573 672913420 672914983 0 2652
17 TraesCS1D01G183200 chr3D 98.637 1394 16 2 1 1392 24168398 24167006 0 2466
18 TraesCS1D01G183200 chr3D 99.375 800 4 1 1574 2372 346083578 346084377 0 1448
19 TraesCS1D01G183200 chr7D 99.249 799 6 0 1574 2372 164288264 164287466 0 1443
20 TraesCS1D01G183200 chr4D 99.249 799 6 0 1574 2372 157668576 157669374 0 1443
21 TraesCS1D01G183200 chr4D 91.121 856 63 7 720 1573 349797059 349797903 0 1147


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G183200 chr1D 254520285 254522656 2371 True 4381 4381 100.000 1 2372 1 chr1D.!!$R1 2371
1 TraesCS1D01G183200 chr5D 560879826 560881399 1573 True 2789 2789 98.667 1 1573 1 chr5D.!!$R2 1572
2 TraesCS1D01G183200 chr5D 503213235 503214805 1570 True 2743 2743 98.159 1 1573 1 chr5D.!!$R1 1572
3 TraesCS1D01G183200 chrUn 93413046 93416990 3944 False 2337 2771 98.423 1 1573 2 chrUn.!!$F1 1572
4 TraesCS1D01G183200 chr6D 168246561 168248126 1565 True 2748 2748 98.285 1 1572 1 chr6D.!!$R1 1571
5 TraesCS1D01G183200 chr6D 229453809 229454609 800 False 1441 1441 99.126 1572 2372 1 chr6D.!!$F2 800
6 TraesCS1D01G183200 chr6D 24415778 24416577 799 False 1437 1437 99.125 1574 2372 1 chr6D.!!$F1 798
7 TraesCS1D01G183200 chr2D 272797307 272798876 1569 False 2724 2724 97.968 1 1573 1 chr2D.!!$F3 1572
8 TraesCS1D01G183200 chr2D 635585966 635587204 1238 False 2182 2182 98.468 1 1237 1 chr2D.!!$F4 1236
9 TraesCS1D01G183200 chr2D 190385691 190386490 799 False 1454 1454 99.500 1574 2372 1 chr2D.!!$F2 798
10 TraesCS1D01G183200 chr2D 295183313 295184111 798 True 1448 1448 99.374 1574 2372 1 chr2D.!!$R1 798
11 TraesCS1D01G183200 chr2D 190377520 190378319 799 False 1443 1443 99.250 1574 2372 1 chr2D.!!$F1 798
12 TraesCS1D01G183200 chr2D 461751168 461751966 798 True 1443 1443 99.249 1574 2372 1 chr2D.!!$R2 798
13 TraesCS1D01G183200 chr3B 201522033 201523597 1564 True 2697 2697 97.711 1 1571 1 chr3B.!!$R1 1570
14 TraesCS1D01G183200 chr1A 584778474 584780031 1557 True 2682 2682 97.642 1 1569 1 chr1A.!!$R1 1568
15 TraesCS1D01G183200 chr3A 672913420 672914983 1563 False 2652 2652 97.205 1 1573 1 chr3A.!!$F1 1572
16 TraesCS1D01G183200 chr3D 24167006 24168398 1392 True 2466 2466 98.637 1 1392 1 chr3D.!!$R1 1391
17 TraesCS1D01G183200 chr3D 346083578 346084377 799 False 1448 1448 99.375 1574 2372 1 chr3D.!!$F1 798
18 TraesCS1D01G183200 chr7D 164287466 164288264 798 True 1443 1443 99.249 1574 2372 1 chr7D.!!$R1 798
19 TraesCS1D01G183200 chr4D 157668576 157669374 798 False 1443 1443 99.249 1574 2372 1 chr4D.!!$F1 798
20 TraesCS1D01G183200 chr4D 349797059 349797903 844 False 1147 1147 91.121 720 1573 1 chr4D.!!$F2 853

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
612 2986 0.596083 GGATCACGGCGAGACAGATG 60.596 60.0 16.62 0.0 0.0 2.9 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2289 4685 4.525487 TGACCTTATGACAACTAGAACCGT 59.475 41.667 0.0 0.0 0.0 4.83 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
160 161 7.186804 ACCGCGATTCAATAAGAGTAAAAATG 58.813 34.615 8.23 0.0 0.00 2.32
348 353 8.743085 ATGTGTATCTATCCGTACCGTAATAT 57.257 34.615 0.00 0.0 0.00 1.28
499 2873 8.395605 ACTATAACCCCAAAAGAACCAGATTTA 58.604 33.333 0.00 0.0 0.00 1.40
612 2986 0.596083 GGATCACGGCGAGACAGATG 60.596 60.000 16.62 0.0 0.00 2.90
629 3003 1.478510 GATGGAAGCAGGACGAAGAGA 59.521 52.381 0.00 0.0 0.00 3.10
738 3112 3.009714 GGCTCGGGAAAGGGGTCT 61.010 66.667 0.00 0.0 0.00 3.85
809 3183 2.333688 GGGGGAGTATCTGAAACTGC 57.666 55.000 0.00 0.0 34.82 4.40
965 3342 9.158233 ACAATATTTCTTTCATCCTTTTGCATG 57.842 29.630 0.00 0.0 0.00 4.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
499 2873 6.240894 TCATTCTTCCTCTATGTTGTTTGCT 58.759 36.000 0.00 0.00 0.00 3.91
538 2912 4.279671 ACCAAAACAAATACGATTGCCTCA 59.720 37.500 0.00 0.00 33.52 3.86
583 2957 2.398554 CCGTGATCCAAGCGGGTTG 61.399 63.158 12.77 12.77 41.60 3.77
612 2986 2.457366 TTTCTCTTCGTCCTGCTTCC 57.543 50.000 0.00 0.00 0.00 3.46
629 3003 4.431894 CGACGTGCATATCGTGTTATTT 57.568 40.909 5.50 0.00 41.64 1.40
682 3056 4.129380 GGTCTTAGTGTAACCGGTTTGTT 58.871 43.478 27.64 11.51 37.80 2.83
738 3112 2.612000 ACGGATACCCAATATTCGGGA 58.388 47.619 22.43 8.08 45.37 5.14
1940 4333 5.190132 TCCCTTTTTCTATACCGGATTGTCA 59.810 40.000 9.46 0.00 0.00 3.58
2289 4685 4.525487 TGACCTTATGACAACTAGAACCGT 59.475 41.667 0.00 0.00 0.00 4.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.