Multiple sequence alignment - TraesCS1D01G183100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G183100 chr1D 100.000 3386 0 0 1 3386 254500933 254504318 0 6253
1 TraesCS1D01G183100 chr1D 99.032 1446 13 1 4 1448 206074426 206072981 0 2591
2 TraesCS1D01G183100 chr1D 95.563 879 30 7 1435 2306 476655576 476654700 0 1399
3 TraesCS1D01G183100 chr5D 98.755 1446 17 1 1 1445 560875404 560876849 0 2569
4 TraesCS1D01G183100 chr5D 98.057 1441 28 0 5 1445 329192891 329194331 0 2507
5 TraesCS1D01G183100 chr5D 98.623 1089 13 2 2299 3386 560876841 560877928 0 1927
6 TraesCS1D01G183100 chr5D 98.347 1089 17 1 2299 3386 503210280 503211368 0 1910
7 TraesCS1D01G183100 chr5D 97.164 1093 28 3 2296 3386 329194320 329195411 0 1844
8 TraesCS1D01G183100 chr3B 98.548 1446 20 1 1 1445 201517613 201519058 0 2553
9 TraesCS1D01G183100 chr3B 97.980 1089 18 3 2299 3386 201519050 201520135 0 1886
10 TraesCS1D01G183100 chr4D 97.647 1445 32 2 1 1445 19919423 19920865 0 2479
11 TraesCS1D01G183100 chr4D 96.712 1095 32 3 2293 3386 19920851 19921942 0 1820
12 TraesCS1D01G183100 chr4D 95.677 879 28 8 1436 2306 100851146 100852022 0 1404
13 TraesCS1D01G183100 chr5A 97.578 1445 35 0 4 1448 283489841 283488397 0 2475
14 TraesCS1D01G183100 chr6A 97.372 1446 33 2 4 1448 260129834 260128393 0 2455
15 TraesCS1D01G183100 chr6A 96.783 1088 31 3 2299 3385 260128404 260127320 0 1812
16 TraesCS1D01G183100 chrUn 99.175 1333 11 0 4 1336 93421926 93420594 0 2401
17 TraesCS1D01G183100 chrUn 98.714 1089 13 1 2299 3386 93419977 93418889 0 1932
18 TraesCS1D01G183100 chr7A 96.461 1441 49 2 4 1444 352191094 352189656 0 2377
19 TraesCS1D01G183100 chr7A 97.067 1091 20 6 2299 3386 201369948 201368867 0 1827
20 TraesCS1D01G183100 chr1A 96.051 1089 31 8 2300 3386 168446231 168445153 0 1762
21 TraesCS1D01G183100 chr7D 97.936 872 14 2 1440 2307 268140843 268139972 0 1507
22 TraesCS1D01G183100 chr7D 97.902 858 14 2 1445 2298 183433237 183434094 0 1482
23 TraesCS1D01G183100 chr7D 97.225 865 14 5 1445 2299 117908259 117909123 0 1456
24 TraesCS1D01G183100 chr2D 97.368 874 17 4 1439 2307 422643822 422642950 0 1482
25 TraesCS1D01G183100 chr3D 97.561 861 17 2 1446 2302 405317554 405316694 0 1471
26 TraesCS1D01G183100 chr3D 97.442 860 13 3 1445 2300 465129282 465128428 0 1458
27 TraesCS1D01G183100 chr3D 95.667 877 28 8 1438 2305 61825302 61824427 0 1400


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G183100 chr1D 254500933 254504318 3385 False 6253.0 6253 100.0000 1 3386 1 chr1D.!!$F1 3385
1 TraesCS1D01G183100 chr1D 206072981 206074426 1445 True 2591.0 2591 99.0320 4 1448 1 chr1D.!!$R1 1444
2 TraesCS1D01G183100 chr1D 476654700 476655576 876 True 1399.0 1399 95.5630 1435 2306 1 chr1D.!!$R2 871
3 TraesCS1D01G183100 chr5D 560875404 560877928 2524 False 2248.0 2569 98.6890 1 3386 2 chr5D.!!$F3 3385
4 TraesCS1D01G183100 chr5D 329192891 329195411 2520 False 2175.5 2507 97.6105 5 3386 2 chr5D.!!$F2 3381
5 TraesCS1D01G183100 chr5D 503210280 503211368 1088 False 1910.0 1910 98.3470 2299 3386 1 chr5D.!!$F1 1087
6 TraesCS1D01G183100 chr3B 201517613 201520135 2522 False 2219.5 2553 98.2640 1 3386 2 chr3B.!!$F1 3385
7 TraesCS1D01G183100 chr4D 19919423 19921942 2519 False 2149.5 2479 97.1795 1 3386 2 chr4D.!!$F2 3385
8 TraesCS1D01G183100 chr4D 100851146 100852022 876 False 1404.0 1404 95.6770 1436 2306 1 chr4D.!!$F1 870
9 TraesCS1D01G183100 chr5A 283488397 283489841 1444 True 2475.0 2475 97.5780 4 1448 1 chr5A.!!$R1 1444
10 TraesCS1D01G183100 chr6A 260127320 260129834 2514 True 2133.5 2455 97.0775 4 3385 2 chr6A.!!$R1 3381
11 TraesCS1D01G183100 chrUn 93418889 93421926 3037 True 2166.5 2401 98.9445 4 3386 2 chrUn.!!$R1 3382
12 TraesCS1D01G183100 chr7A 352189656 352191094 1438 True 2377.0 2377 96.4610 4 1444 1 chr7A.!!$R2 1440
13 TraesCS1D01G183100 chr7A 201368867 201369948 1081 True 1827.0 1827 97.0670 2299 3386 1 chr7A.!!$R1 1087
14 TraesCS1D01G183100 chr1A 168445153 168446231 1078 True 1762.0 1762 96.0510 2300 3386 1 chr1A.!!$R1 1086
15 TraesCS1D01G183100 chr7D 268139972 268140843 871 True 1507.0 1507 97.9360 1440 2307 1 chr7D.!!$R1 867
16 TraesCS1D01G183100 chr7D 183433237 183434094 857 False 1482.0 1482 97.9020 1445 2298 1 chr7D.!!$F2 853
17 TraesCS1D01G183100 chr7D 117908259 117909123 864 False 1456.0 1456 97.2250 1445 2299 1 chr7D.!!$F1 854
18 TraesCS1D01G183100 chr2D 422642950 422643822 872 True 1482.0 1482 97.3680 1439 2307 1 chr2D.!!$R1 868
19 TraesCS1D01G183100 chr3D 405316694 405317554 860 True 1471.0 1471 97.5610 1446 2302 1 chr3D.!!$R2 856
20 TraesCS1D01G183100 chr3D 465128428 465129282 854 True 1458.0 1458 97.4420 1445 2300 1 chr3D.!!$R3 855
21 TraesCS1D01G183100 chr3D 61824427 61825302 875 True 1400.0 1400 95.6670 1438 2305 1 chr3D.!!$R1 867

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
657 658 7.136203 AGAAGGGATCTAAGGAAGAATGTAGT 58.864 38.462 0.0 0.0 37.89 2.73 F
2212 2739 0.037697 CATTCAAGGGACCACGACGA 60.038 55.000 0.0 0.0 0.00 4.20 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2261 2792 1.565067 ACCCCTAGTTGGTTCCTACG 58.435 55.000 0.0 0.0 29.75 3.51 R
3164 3699 3.614092 TGACAGAGCCCATTGATTTCTC 58.386 45.455 0.0 0.0 0.00 2.87 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
657 658 7.136203 AGAAGGGATCTAAGGAAGAATGTAGT 58.864 38.462 0.00 0.00 37.89 2.73
1143 1659 2.759560 GAACCCGCATGGCCCAAT 60.760 61.111 0.00 0.00 37.83 3.16
1219 1735 0.108804 TTTAGCGGTTCTCGAGCCAG 60.109 55.000 7.81 2.63 42.43 4.85
1260 1776 2.832129 AGATCCGTTTGCAACTCCTCTA 59.168 45.455 0.00 0.00 0.00 2.43
1569 2085 0.678950 AATGCCCTTTGACCGTTTGG 59.321 50.000 0.00 0.00 42.84 3.28
1687 2203 7.464977 GCATATCATTTGCATTCAGGACAAAAC 60.465 37.037 0.00 0.00 39.90 2.43
2198 2725 1.339610 CAAACGGTCAAAGGGCATTCA 59.660 47.619 0.00 0.00 0.00 2.57
2212 2739 0.037697 CATTCAAGGGACCACGACGA 60.038 55.000 0.00 0.00 0.00 4.20
2538 3069 9.045223 ACCAAAGATGCTAAATTGTTTTCTTTC 57.955 29.630 0.00 0.00 0.00 2.62
2824 3356 9.389755 TGGAATTCCTTTTTGTTTTTCTTTAGG 57.610 29.630 24.73 0.00 36.82 2.69
2992 3524 4.703575 GGGGTTAAACTTCCATTAGTCCAC 59.296 45.833 0.00 0.00 0.00 4.02
3038 3571 6.486320 GTGTTTTTCATTTCCATTCCCACAAT 59.514 34.615 0.00 0.00 0.00 2.71
3368 3903 7.649533 TCTTGTACGGATTCTTCAATACCTA 57.350 36.000 0.00 0.00 0.00 3.08
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
458 459 0.676466 TGGATGACATGGTTGCGGTC 60.676 55.000 0.00 0.0 0.00 4.79
1219 1735 0.458370 GCCGGTTCACCAATCATTGC 60.458 55.000 1.90 0.0 35.14 3.56
1687 2203 3.329814 ACCTCAGGTAGTTTAAAGGGTGG 59.670 47.826 0.00 0.0 32.11 4.61
2054 2580 3.708890 TGCATTCAAGACAAAAGCACTG 58.291 40.909 0.00 0.0 0.00 3.66
2055 2581 4.389890 TTGCATTCAAGACAAAAGCACT 57.610 36.364 0.00 0.0 0.00 4.40
2198 2725 3.784642 TTTTTCGTCGTGGTCCCTT 57.215 47.368 0.00 0.0 0.00 3.95
2261 2792 1.565067 ACCCCTAGTTGGTTCCTACG 58.435 55.000 0.00 0.0 29.75 3.51
2664 3195 6.867662 TCTTCTGAGAATTGACAGTTTTCC 57.132 37.500 0.00 0.0 35.84 3.13
2840 3372 3.887110 ACTCCACCCCTTTTTACTTTTCG 59.113 43.478 0.00 0.0 0.00 3.46
3118 3653 6.299922 AGATCGTGGATATCAGACAGAACTA 58.700 40.000 4.83 0.0 0.00 2.24
3164 3699 3.614092 TGACAGAGCCCATTGATTTCTC 58.386 45.455 0.00 0.0 0.00 2.87


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.