Multiple sequence alignment - TraesCS1D01G183000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G183000 chr1D 100.000 2699 0 0 1 2699 254499341 254502039 0.000000e+00 4985.0
1 TraesCS1D01G183000 chr1D 99.265 2178 15 1 523 2699 206075500 206073323 0.000000e+00 3932.0
2 TraesCS1D01G183000 chr5D 98.889 2700 29 1 1 2699 560873811 560876510 0.000000e+00 4819.0
3 TraesCS1D01G183000 chr5D 97.703 2699 40 5 1 2699 6199939 6197263 0.000000e+00 4621.0
4 TraesCS1D01G183000 chr5D 98.164 1688 31 0 1012 2699 329192306 329193993 0.000000e+00 2946.0
5 TraesCS1D01G183000 chr5D 97.833 1015 17 5 1 1014 329163520 329164530 0.000000e+00 1748.0
6 TraesCS1D01G183000 chr3B 98.592 2699 36 2 1 2699 201516023 201518719 0.000000e+00 4772.0
7 TraesCS1D01G183000 chr3B 98.507 201 3 0 1 201 201514981 201515181 3.310000e-94 355.0
8 TraesCS1D01G183000 chr3B 97.778 45 1 0 336 380 590453070 590453026 8.010000e-11 78.7
9 TraesCS1D01G183000 chr4D 97.406 2699 64 3 1 2699 19917836 19920528 0.000000e+00 4591.0
10 TraesCS1D01G183000 chr1A 96.443 2699 64 10 1 2699 168449227 168446561 0.000000e+00 4423.0
11 TraesCS1D01G183000 chr7A 96.150 2701 92 8 1 2699 352192682 352189992 0.000000e+00 4401.0
12 TraesCS1D01G183000 chr7B 96.710 2523 66 7 174 2696 102632114 102629609 0.000000e+00 4183.0
13 TraesCS1D01G183000 chr6A 97.911 2011 36 2 691 2699 260130741 260128735 0.000000e+00 3476.0
14 TraesCS1D01G183000 chrUn 99.365 1102 6 1 438 1539 439559440 439558340 0.000000e+00 1995.0
15 TraesCS1D01G183000 chr1B 97.735 309 7 0 1 309 65450310 65450618 1.420000e-147 532.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G183000 chr1D 254499341 254502039 2698 False 4985.0 4985 100.0000 1 2699 1 chr1D.!!$F1 2698
1 TraesCS1D01G183000 chr1D 206073323 206075500 2177 True 3932.0 3932 99.2650 523 2699 1 chr1D.!!$R1 2176
2 TraesCS1D01G183000 chr5D 560873811 560876510 2699 False 4819.0 4819 98.8890 1 2699 1 chr5D.!!$F3 2698
3 TraesCS1D01G183000 chr5D 6197263 6199939 2676 True 4621.0 4621 97.7030 1 2699 1 chr5D.!!$R1 2698
4 TraesCS1D01G183000 chr5D 329192306 329193993 1687 False 2946.0 2946 98.1640 1012 2699 1 chr5D.!!$F2 1687
5 TraesCS1D01G183000 chr5D 329163520 329164530 1010 False 1748.0 1748 97.8330 1 1014 1 chr5D.!!$F1 1013
6 TraesCS1D01G183000 chr3B 201514981 201518719 3738 False 2563.5 4772 98.5495 1 2699 2 chr3B.!!$F1 2698
7 TraesCS1D01G183000 chr4D 19917836 19920528 2692 False 4591.0 4591 97.4060 1 2699 1 chr4D.!!$F1 2698
8 TraesCS1D01G183000 chr1A 168446561 168449227 2666 True 4423.0 4423 96.4430 1 2699 1 chr1A.!!$R1 2698
9 TraesCS1D01G183000 chr7A 352189992 352192682 2690 True 4401.0 4401 96.1500 1 2699 1 chr7A.!!$R1 2698
10 TraesCS1D01G183000 chr7B 102629609 102632114 2505 True 4183.0 4183 96.7100 174 2696 1 chr7B.!!$R1 2522
11 TraesCS1D01G183000 chr6A 260128735 260130741 2006 True 3476.0 3476 97.9110 691 2699 1 chr6A.!!$R1 2008
12 TraesCS1D01G183000 chrUn 439558340 439559440 1100 True 1995.0 1995 99.3650 438 1539 1 chrUn.!!$R1 1101

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
784 1831 9.997172 ACAAATCCTTTATAGGGAAGAGAAAAT 57.003 29.63 0.0 0.0 42.26 1.82 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2050 3103 0.676466 TGGATGACATGGTTGCGGTC 60.676 55.0 0.0 0.0 0.0 4.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
784 1831 9.997172 ACAAATCCTTTATAGGGAAGAGAAAAT 57.003 29.630 0.0 0.0 42.26 1.82
2249 3302 7.136203 AGAAGGGATCTAAGGAAGAATGTAGT 58.864 38.462 0.0 0.0 37.89 2.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
784 1831 4.908601 TGGTCATTAGAGGCTTCTTGAA 57.091 40.909 2.68 0.0 34.79 2.69
1018 2065 0.259356 CCGAGTCCCCCTCTAAGAGT 59.741 60.000 0.00 0.0 38.11 3.24
2050 3103 0.676466 TGGATGACATGGTTGCGGTC 60.676 55.000 0.00 0.0 0.00 4.79


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.