Multiple sequence alignment - TraesCS1D01G182900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G182900 chr1D 100.000 2222 0 0 1 2222 254498293 254500514 0.000000e+00 4104.0
1 TraesCS1D01G182900 chr1D 92.092 1821 94 30 1 1814 244483754 244481977 0.000000e+00 2519.0
2 TraesCS1D01G182900 chr5D 98.740 2223 27 1 1 2222 560872763 560874985 0.000000e+00 3949.0
3 TraesCS1D01G182900 chr5D 97.076 2223 41 7 1 2222 6200986 6198787 0.000000e+00 3723.0
4 TraesCS1D01G182900 chr5D 97.867 2063 39 5 1 2062 329162472 329164530 0.000000e+00 3561.0
5 TraesCS1D01G182900 chr4D 96.895 2222 66 3 1 2222 19916790 19919008 0.000000e+00 3718.0
6 TraesCS1D01G182900 chr1A 96.760 2222 64 7 1 2222 168450272 168448059 0.000000e+00 3698.0
7 TraesCS1D01G182900 chr7A 95.414 2224 95 7 1 2222 352193729 352191511 0.000000e+00 3535.0
8 TraesCS1D01G182900 chr3B 97.899 1618 29 5 607 2222 201515580 201517194 0.000000e+00 2795.0
9 TraesCS1D01G182900 chr3B 93.900 1000 46 6 1223 2222 524777564 524776580 0.000000e+00 1495.0
10 TraesCS1D01G182900 chr3B 97.778 45 1 0 1384 1428 590453070 590453026 6.580000e-11 78.7
11 TraesCS1D01G182900 chr6B 96.880 1186 35 2 1 1185 22426239 22427423 0.000000e+00 1984.0
12 TraesCS1D01G182900 chrUn 98.009 1055 19 2 231 1284 445812538 445811485 0.000000e+00 1831.0
13 TraesCS1D01G182900 chrUn 99.186 737 5 1 1486 2222 439559440 439558705 0.000000e+00 1327.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G182900 chr1D 254498293 254500514 2221 False 4104 4104 100.000 1 2222 1 chr1D.!!$F1 2221
1 TraesCS1D01G182900 chr1D 244481977 244483754 1777 True 2519 2519 92.092 1 1814 1 chr1D.!!$R1 1813
2 TraesCS1D01G182900 chr5D 560872763 560874985 2222 False 3949 3949 98.740 1 2222 1 chr5D.!!$F2 2221
3 TraesCS1D01G182900 chr5D 6198787 6200986 2199 True 3723 3723 97.076 1 2222 1 chr5D.!!$R1 2221
4 TraesCS1D01G182900 chr5D 329162472 329164530 2058 False 3561 3561 97.867 1 2062 1 chr5D.!!$F1 2061
5 TraesCS1D01G182900 chr4D 19916790 19919008 2218 False 3718 3718 96.895 1 2222 1 chr4D.!!$F1 2221
6 TraesCS1D01G182900 chr1A 168448059 168450272 2213 True 3698 3698 96.760 1 2222 1 chr1A.!!$R1 2221
7 TraesCS1D01G182900 chr7A 352191511 352193729 2218 True 3535 3535 95.414 1 2222 1 chr7A.!!$R1 2221
8 TraesCS1D01G182900 chr3B 201515580 201517194 1614 False 2795 2795 97.899 607 2222 1 chr3B.!!$F1 1615
9 TraesCS1D01G182900 chr3B 524776580 524777564 984 True 1495 1495 93.900 1223 2222 1 chr3B.!!$R1 999
10 TraesCS1D01G182900 chr6B 22426239 22427423 1184 False 1984 1984 96.880 1 1185 1 chr6B.!!$F1 1184
11 TraesCS1D01G182900 chrUn 445811485 445812538 1053 True 1831 1831 98.009 231 1284 1 chrUn.!!$R2 1053
12 TraesCS1D01G182900 chrUn 439558705 439559440 735 True 1327 1327 99.186 1486 2222 1 chrUn.!!$R1 736

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
271 272 1.28953 AGGGGTTGGTTCACTTTTGGA 59.71 47.619 0.0 0.0 0.0 3.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2066 2075 0.259356 CCGAGTCCCCCTCTAAGAGT 59.741 60.0 0.0 0.0 38.11 3.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
271 272 1.289530 AGGGGTTGGTTCACTTTTGGA 59.710 47.619 0.00 0.0 0.00 3.53
328 329 1.643868 TTTGGCATGGCGCTAGAACG 61.644 55.000 15.27 0.0 41.91 3.95
356 357 4.394920 TCCGAGATGTTTTTGCTGGTATTC 59.605 41.667 0.00 0.0 0.00 1.75
804 808 6.925610 TCGAATGGATCTCTTAATTGTTGG 57.074 37.500 0.00 0.0 0.00 3.77
964 968 8.646356 CGTGTATTTACAACTACAACGGAATAA 58.354 33.333 0.00 0.0 38.04 1.40
1832 1840 9.997172 ACAAATCCTTTATAGGGAAGAGAAAAT 57.003 29.630 0.00 0.0 42.26 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
271 272 2.229784 GAGCAAAGCAAAGGTAGCATGT 59.770 45.455 0.00 0.0 0.00 3.21
328 329 3.730715 CAGCAAAAACATCTCGGAACAAC 59.269 43.478 0.00 0.0 0.00 3.32
1832 1840 4.908601 TGGTCATTAGAGGCTTCTTGAA 57.091 40.909 2.68 0.0 34.79 2.69
2066 2075 0.259356 CCGAGTCCCCCTCTAAGAGT 59.741 60.000 0.00 0.0 38.11 3.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.