Multiple sequence alignment - TraesCS1D01G182500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G182500 chr1D 100.000 2650 0 0 1 2650 254497716 254495067 0 4894
1 TraesCS1D01G182500 chr1D 97.743 2348 24 7 319 2650 483915214 483917548 0 4015
2 TraesCS1D01G182500 chr1D 97.188 1636 15 6 3 1609 19957750 19956117 0 2737
3 TraesCS1D01G182500 chr5D 98.575 2666 22 6 1 2650 240137425 240134760 0 4698
4 TraesCS1D01G182500 chr5D 97.974 2665 34 10 1 2650 6201560 6204219 0 4604
5 TraesCS1D01G182500 chr3B 98.161 2665 34 6 1 2650 201512847 201510183 0 4636
6 TraesCS1D01G182500 chr4D 96.396 2664 79 7 1 2649 19916216 19913555 0 4372
7 TraesCS1D01G182500 chr3D 98.277 2321 24 8 1 2307 21904344 21902026 0 4050
8 TraesCS1D01G182500 chr3D 98.767 892 7 3 1763 2650 21902036 21901145 0 1583
9 TraesCS1D01G182500 chr6B 97.321 1792 35 5 1 1780 22425663 22423873 0 3031
10 TraesCS1D01G182500 chr2D 97.837 1572 26 6 1085 2650 334231119 334229550 0 2708
11 TraesCS1D01G182500 chr1A 98.216 1345 10 8 2 1333 112776315 112777658 0 2338
12 TraesCS1D01G182500 chr2B 98.251 1315 18 3 1333 2643 474897223 474898536 0 2296
13 TraesCS1D01G182500 chr7A 96.266 857 22 2 1 847 352202392 352203248 0 1397


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G182500 chr1D 254495067 254497716 2649 True 4894.0 4894 100.000 1 2650 1 chr1D.!!$R2 2649
1 TraesCS1D01G182500 chr1D 483915214 483917548 2334 False 4015.0 4015 97.743 319 2650 1 chr1D.!!$F1 2331
2 TraesCS1D01G182500 chr1D 19956117 19957750 1633 True 2737.0 2737 97.188 3 1609 1 chr1D.!!$R1 1606
3 TraesCS1D01G182500 chr5D 240134760 240137425 2665 True 4698.0 4698 98.575 1 2650 1 chr5D.!!$R1 2649
4 TraesCS1D01G182500 chr5D 6201560 6204219 2659 False 4604.0 4604 97.974 1 2650 1 chr5D.!!$F1 2649
5 TraesCS1D01G182500 chr3B 201510183 201512847 2664 True 4636.0 4636 98.161 1 2650 1 chr3B.!!$R1 2649
6 TraesCS1D01G182500 chr4D 19913555 19916216 2661 True 4372.0 4372 96.396 1 2649 1 chr4D.!!$R1 2648
7 TraesCS1D01G182500 chr3D 21901145 21904344 3199 True 2816.5 4050 98.522 1 2650 2 chr3D.!!$R1 2649
8 TraesCS1D01G182500 chr6B 22423873 22425663 1790 True 3031.0 3031 97.321 1 1780 1 chr6B.!!$R1 1779
9 TraesCS1D01G182500 chr2D 334229550 334231119 1569 True 2708.0 2708 97.837 1085 2650 1 chr2D.!!$R1 1565
10 TraesCS1D01G182500 chr1A 112776315 112777658 1343 False 2338.0 2338 98.216 2 1333 1 chr1A.!!$F1 1331
11 TraesCS1D01G182500 chr2B 474897223 474898536 1313 False 2296.0 2296 98.251 1333 2643 1 chr2B.!!$F1 1310
12 TraesCS1D01G182500 chr7A 352202392 352203248 856 False 1397.0 1397 96.266 1 847 1 chr7A.!!$F1 846

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
806 817 3.489738 GCATTCGAATCACCCATTCCTTG 60.49 47.826 7.92 0.0 38.17 3.61 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1842 1878 4.669874 GCGCGGCCGTTTTTCGAA 62.67 61.111 28.7 0.0 42.86 3.71 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
806 817 3.489738 GCATTCGAATCACCCATTCCTTG 60.490 47.826 7.92 0.00 38.17 3.61
820 833 7.393234 CACCCATTCCTTGTTCTTTACAATCTA 59.607 37.037 0.00 0.00 45.31 1.98
1246 1260 9.597681 AATCTCAGGAATGGCTATTTTTGATAT 57.402 29.630 9.50 6.59 0.00 1.63
1347 1381 2.547826 GAGAACCCACCAAGCGTATAC 58.452 52.381 0.00 0.00 0.00 1.47
1348 1382 1.903860 AGAACCCACCAAGCGTATACA 59.096 47.619 3.32 0.00 0.00 2.29
1417 1451 0.251916 CGGGCAAGGACACCAGAATA 59.748 55.000 0.00 0.00 0.00 1.75
1528 1562 2.092968 CCGAAGACATGGAAAGGGATGA 60.093 50.000 0.00 0.00 0.00 2.92
1576 1610 4.752101 AGCTTATGGACTTGTCGATATTGC 59.248 41.667 15.68 15.68 0.00 3.56
1842 1878 3.119849 GCAAGACAGCCAATACGAAATGT 60.120 43.478 0.00 0.00 0.00 2.71
2475 3054 4.776837 TCGTGGTTGGGAAGGTTACTATAA 59.223 41.667 0.00 0.00 0.00 0.98
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1246 1260 0.464554 TGGTGTCACCGTTTGCATCA 60.465 50.000 17.27 0.0 42.58 3.07
1528 1562 3.375299 GGCTTCGTCTGCTGACATAAAAT 59.625 43.478 21.72 0.0 43.06 1.82
1576 1610 4.441079 GCTTGTCAATCATTTCATCCCCTG 60.441 45.833 0.00 0.0 0.00 4.45
1842 1878 4.669874 GCGCGGCCGTTTTTCGAA 62.670 61.111 28.70 0.0 42.86 3.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.