Multiple sequence alignment - TraesCS1D01G182300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G182300 chr1D 100.000 2114 0 0 1 2114 254489404 254491517 0 3904
1 TraesCS1D01G182300 chr1D 96.852 2160 21 14 1 2114 394178613 394180771 0 3568
2 TraesCS1D01G182300 chr1D 98.609 575 7 1 1539 2113 483921678 483921105 0 1016
3 TraesCS1D01G182300 chrUn 97.032 2156 20 7 1 2113 317473487 317471333 0 3587
4 TraesCS1D01G182300 chr6D 96.935 2153 22 6 1 2114 431399733 431401880 0 3570
5 TraesCS1D01G182300 chr6D 98.611 576 7 1 1539 2114 431404187 431404761 0 1018
6 TraesCS1D01G182300 chr6D 98.438 576 8 1 1539 2114 431402933 431402359 0 1013
7 TraesCS1D01G182300 chr3D 96.640 2143 30 19 1 2114 21897263 21899392 0 3520
8 TraesCS1D01G182300 chr5D 96.329 2152 32 7 1 2114 6208111 6205969 0 3493
9 TraesCS1D01G182300 chr5D 97.699 1130 23 2 1 1129 329132001 329130874 0 1940
10 TraesCS1D01G182300 chr5D 98.438 576 8 1 1539 2114 554198095 554198669 0 1013
11 TraesCS1D01G182300 chr5D 98.264 576 7 2 1539 2114 554199720 554199148 0 1005
12 TraesCS1D01G182300 chr2A 96.576 2103 42 18 1 2077 335825982 335828080 0 3458
13 TraesCS1D01G182300 chr3B 95.682 2154 49 16 1 2114 201506282 201508431 0 3422
14 TraesCS1D01G182300 chr2D 95.444 2151 48 10 1 2113 334225628 334227766 0 3384
15 TraesCS1D01G182300 chr2D 98.535 1229 6 5 1 1219 628285372 628286598 0 2159
16 TraesCS1D01G182300 chr1A 97.680 776 17 1 1 775 256026464 256025689 0 1332


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G182300 chr1D 254489404 254491517 2113 False 3904 3904 100.000 1 2114 1 chr1D.!!$F1 2113
1 TraesCS1D01G182300 chr1D 394178613 394180771 2158 False 3568 3568 96.852 1 2114 1 chr1D.!!$F2 2113
2 TraesCS1D01G182300 chr1D 483921105 483921678 573 True 1016 1016 98.609 1539 2113 1 chr1D.!!$R1 574
3 TraesCS1D01G182300 chrUn 317471333 317473487 2154 True 3587 3587 97.032 1 2113 1 chrUn.!!$R1 2112
4 TraesCS1D01G182300 chr6D 431399733 431404761 5028 False 2294 3570 97.773 1 2114 2 chr6D.!!$F1 2113
5 TraesCS1D01G182300 chr6D 431402359 431402933 574 True 1013 1013 98.438 1539 2114 1 chr6D.!!$R1 575
6 TraesCS1D01G182300 chr3D 21897263 21899392 2129 False 3520 3520 96.640 1 2114 1 chr3D.!!$F1 2113
7 TraesCS1D01G182300 chr5D 6205969 6208111 2142 True 3493 3493 96.329 1 2114 1 chr5D.!!$R1 2113
8 TraesCS1D01G182300 chr5D 329130874 329132001 1127 True 1940 1940 97.699 1 1129 1 chr5D.!!$R2 1128
9 TraesCS1D01G182300 chr5D 554198095 554198669 574 False 1013 1013 98.438 1539 2114 1 chr5D.!!$F1 575
10 TraesCS1D01G182300 chr5D 554199148 554199720 572 True 1005 1005 98.264 1539 2114 1 chr5D.!!$R3 575
11 TraesCS1D01G182300 chr2A 335825982 335828080 2098 False 3458 3458 96.576 1 2077 1 chr2A.!!$F1 2076
12 TraesCS1D01G182300 chr3B 201506282 201508431 2149 False 3422 3422 95.682 1 2114 1 chr3B.!!$F1 2113
13 TraesCS1D01G182300 chr2D 334225628 334227766 2138 False 3384 3384 95.444 1 2113 1 chr2D.!!$F1 2112
14 TraesCS1D01G182300 chr2D 628285372 628286598 1226 False 2159 2159 98.535 1 1219 1 chr2D.!!$F2 1218
15 TraesCS1D01G182300 chr1A 256025689 256026464 775 True 1332 1332 97.680 1 775 1 chr1A.!!$R1 774

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
366 377 4.263949 ACTCCAAAAAGAGGGTCCTATTGG 60.264 45.833 13.01 13.01 38.26 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1397 1434 3.186001 GGCAGTAGCGATGAGATCAATTG 59.814 47.826 0.0 0.0 43.41 2.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
74 75 8.504815 GTTTGTTGGATTAGGTCTAACTTTCTC 58.495 37.037 5.99 0.00 45.53 2.87
366 377 4.263949 ACTCCAAAAAGAGGGTCCTATTGG 60.264 45.833 13.01 13.01 38.26 3.16
822 854 6.837992 TGAACAAGATACGCCTTATTTGAAC 58.162 36.000 0.00 0.00 0.00 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
74 75 4.430423 GCGCTCGCAGTTTGGTCG 62.430 66.667 9.59 0.0 41.49 4.79
1055 1088 1.206132 ACGCAGTCACGAATAATCCCA 59.794 47.619 0.00 0.0 29.74 4.37
1397 1434 3.186001 GGCAGTAGCGATGAGATCAATTG 59.814 47.826 0.00 0.0 43.41 2.32
1589 1698 8.524487 AGAAATGACACGAGGGTTCTATATATC 58.476 37.037 0.00 0.0 0.00 1.63


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.