Multiple sequence alignment - TraesCS1D01G182200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G182200 chr1D 100.000 2096 0 0 1 2096 254489129 254491224 0.000000e+00 3871.0
1 TraesCS1D01G182200 chr1D 96.967 2143 18 14 1 2096 394178337 394180479 0.000000e+00 3554.0
2 TraesCS1D01G182200 chr1D 99.293 283 2 0 1814 2096 483921678 483921396 1.430000e-141 512.0
3 TraesCS1D01G182200 chrUn 97.195 2139 17 6 1 2096 317473762 317471624 0.000000e+00 3578.0
4 TraesCS1D01G182200 chr6D 97.143 2135 18 5 1 2096 431399458 431401588 0.000000e+00 3565.0
5 TraesCS1D01G182200 chr6D 98.587 283 4 0 1814 2096 431402933 431402651 3.100000e-138 501.0
6 TraesCS1D01G182200 chr6D 98.233 283 5 0 1814 2096 431404187 431404469 1.440000e-136 496.0
7 TraesCS1D01G182200 chr3D 96.706 2125 29 18 1 2096 21896989 21899101 0.000000e+00 3498.0
8 TraesCS1D01G182200 chr2A 96.371 2122 43 17 1 2096 335825713 335827826 0.000000e+00 3461.0
9 TraesCS1D01G182200 chr3B 95.520 2143 47 15 1 2096 201506000 201508140 0.000000e+00 3380.0
10 TraesCS1D01G182200 chr2D 95.421 2140 45 9 1 2096 334225348 334227478 0.000000e+00 3360.0
11 TraesCS1D01G182200 chr2D 98.271 1504 6 6 1 1494 628285105 628286598 0.000000e+00 2615.0
12 TraesCS1D01G182200 chr5D 96.396 2053 28 6 82 2096 6208305 6206261 0.000000e+00 3339.0
13 TraesCS1D01G182200 chr5D 97.309 1412 28 3 1 1404 329132283 329130874 0.000000e+00 2388.0
14 TraesCS1D01G182200 chr5D 98.587 283 4 0 1814 2096 554198095 554198377 3.100000e-138 501.0
15 TraesCS1D01G182200 chr7D 91.667 96 1 1 14 102 635513933 635514028 2.180000e-25 126.0
16 TraesCS1D01G182200 chr7B 100.000 36 0 0 1 36 203720203 203720238 1.340000e-07 67.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G182200 chr1D 254489129 254491224 2095 False 3871.0 3871 100.000 1 2096 1 chr1D.!!$F1 2095
1 TraesCS1D01G182200 chr1D 394178337 394180479 2142 False 3554.0 3554 96.967 1 2096 1 chr1D.!!$F2 2095
2 TraesCS1D01G182200 chrUn 317471624 317473762 2138 True 3578.0 3578 97.195 1 2096 1 chrUn.!!$R1 2095
3 TraesCS1D01G182200 chr6D 431399458 431404469 5011 False 2030.5 3565 97.688 1 2096 2 chr6D.!!$F1 2095
4 TraesCS1D01G182200 chr3D 21896989 21899101 2112 False 3498.0 3498 96.706 1 2096 1 chr3D.!!$F1 2095
5 TraesCS1D01G182200 chr2A 335825713 335827826 2113 False 3461.0 3461 96.371 1 2096 1 chr2A.!!$F1 2095
6 TraesCS1D01G182200 chr3B 201506000 201508140 2140 False 3380.0 3380 95.520 1 2096 1 chr3B.!!$F1 2095
7 TraesCS1D01G182200 chr2D 334225348 334227478 2130 False 3360.0 3360 95.421 1 2096 1 chr2D.!!$F1 2095
8 TraesCS1D01G182200 chr2D 628285105 628286598 1493 False 2615.0 2615 98.271 1 1494 1 chr2D.!!$F2 1493
9 TraesCS1D01G182200 chr5D 6206261 6208305 2044 True 3339.0 3339 96.396 82 2096 1 chr5D.!!$R1 2014
10 TraesCS1D01G182200 chr5D 329130874 329132283 1409 True 2388.0 2388 97.309 1 1404 1 chr5D.!!$R2 1403

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
641 665 4.263949 ACTCCAAAAAGAGGGTCCTATTGG 60.264 45.833 13.01 13.01 38.26 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1672 1724 3.186001 GGCAGTAGCGATGAGATCAATTG 59.814 47.826 0.0 0.0 43.41 2.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
349 371 8.504815 GTTTGTTGGATTAGGTCTAACTTTCTC 58.495 37.037 5.99 0.00 45.53 2.87
641 665 4.263949 ACTCCAAAAAGAGGGTCCTATTGG 60.264 45.833 13.01 13.01 38.26 3.16
1097 1144 6.837992 TGAACAAGATACGCCTTATTTGAAC 58.162 36.000 0.00 0.00 0.00 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
349 371 4.430423 GCGCTCGCAGTTTGGTCG 62.430 66.667 9.59 0.0 41.49 4.79
1330 1378 1.206132 ACGCAGTCACGAATAATCCCA 59.794 47.619 0.00 0.0 29.74 4.37
1672 1724 3.186001 GGCAGTAGCGATGAGATCAATTG 59.814 47.826 0.00 0.0 43.41 2.32
1864 1969 8.524487 AGAAATGACACGAGGGTTCTATATATC 58.476 37.037 0.00 0.0 0.00 1.63


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.