Multiple sequence alignment - TraesCS1D01G182100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G182100 chr1D 100.000 2252 0 0 1 2252 254489978 254487727 0.000000e+00 4159
1 TraesCS1D01G182100 chr1D 99.011 1617 13 2 1 1614 394179189 394177573 0.000000e+00 2894
2 TraesCS1D01G182100 chr1D 95.776 1752 61 7 502 2252 244408393 244406654 0.000000e+00 2813
3 TraesCS1D01G182100 chr1D 95.491 1752 65 8 502 2252 244401942 244400204 0.000000e+00 2785
4 TraesCS1D01G182100 chr1D 94.809 1753 77 7 502 2252 244423930 244422190 0.000000e+00 2721
5 TraesCS1D01G182100 chr6D 98.713 2254 23 4 1 2252 431400303 431398054 0.000000e+00 3997
6 TraesCS1D01G182100 chr2D 98.670 2255 17 5 1 2252 628285945 628283701 0.000000e+00 3986
7 TraesCS1D01G182100 chr2D 97.273 2237 42 10 1 2228 334226198 334223972 0.000000e+00 3775
8 TraesCS1D01G182100 chr3D 98.223 2251 31 5 3 2252 21897830 21895588 0.000000e+00 3927
9 TraesCS1D01G182100 chr5D 97.307 2265 39 7 1 2249 329131429 329133687 0.000000e+00 3825
10 TraesCS1D01G182100 chr2A 96.903 2260 60 4 1 2252 276440798 276443055 0.000000e+00 3777
11 TraesCS1D01G182100 chr2A 96.978 2250 59 4 3 2252 335826554 335824314 0.000000e+00 3770
12 TraesCS1D01G182100 chrUn 99.290 986 5 2 1 984 317472911 317473896 0.000000e+00 1781
13 TraesCS1D01G182100 chr7B 98.413 189 2 1 15 203 8175322 8175135 4.640000e-87 331
14 TraesCS1D01G182100 chr7B 97.884 189 2 2 15 203 8018422 8018236 2.160000e-85 326


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G182100 chr1D 254487727 254489978 2251 True 4159 4159 100.000 1 2252 1 chr1D.!!$R4 2251
1 TraesCS1D01G182100 chr1D 394177573 394179189 1616 True 2894 2894 99.011 1 1614 1 chr1D.!!$R5 1613
2 TraesCS1D01G182100 chr1D 244406654 244408393 1739 True 2813 2813 95.776 502 2252 1 chr1D.!!$R2 1750
3 TraesCS1D01G182100 chr1D 244400204 244401942 1738 True 2785 2785 95.491 502 2252 1 chr1D.!!$R1 1750
4 TraesCS1D01G182100 chr1D 244422190 244423930 1740 True 2721 2721 94.809 502 2252 1 chr1D.!!$R3 1750
5 TraesCS1D01G182100 chr6D 431398054 431400303 2249 True 3997 3997 98.713 1 2252 1 chr6D.!!$R1 2251
6 TraesCS1D01G182100 chr2D 628283701 628285945 2244 True 3986 3986 98.670 1 2252 1 chr2D.!!$R2 2251
7 TraesCS1D01G182100 chr2D 334223972 334226198 2226 True 3775 3775 97.273 1 2228 1 chr2D.!!$R1 2227
8 TraesCS1D01G182100 chr3D 21895588 21897830 2242 True 3927 3927 98.223 3 2252 1 chr3D.!!$R1 2249
9 TraesCS1D01G182100 chr5D 329131429 329133687 2258 False 3825 3825 97.307 1 2249 1 chr5D.!!$F1 2248
10 TraesCS1D01G182100 chr2A 276440798 276443055 2257 False 3777 3777 96.903 1 2252 1 chr2A.!!$F1 2251
11 TraesCS1D01G182100 chr2A 335824314 335826554 2240 True 3770 3770 96.978 3 2252 1 chr2A.!!$R1 2249
12 TraesCS1D01G182100 chrUn 317472911 317473896 985 False 1781 1781 99.290 1 984 1 chrUn.!!$F1 983

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
500 514 4.430423 GCGCTCGCAGTTTGGTCG 62.43 66.667 9.59 0.0 41.49 4.79 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2196 2248 3.078837 TCTTTTGCTTAGGTTTAGCCGG 58.921 45.455 0.0 0.0 43.7 6.13 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
500 514 4.430423 GCGCTCGCAGTTTGGTCG 62.430 66.667 9.59 0.00 41.49 4.79
1022 1060 1.118965 TCTGGAAGCACGGGAGAACA 61.119 55.000 0.00 0.00 0.00 3.18
1165 1203 3.907221 AGTCCTAGGCCAAACGAGTATA 58.093 45.455 5.01 0.00 0.00 1.47
1176 1214 5.107133 CCAAACGAGTATATCACGGAAAGT 58.893 41.667 0.00 0.00 34.65 2.66
1337 1375 3.181499 CGGACTAGCTGTACCTACTGTTG 60.181 52.174 0.00 0.00 0.00 3.33
1775 1820 7.834881 TTGGGTTCATCTCTATAGTAATCGT 57.165 36.000 0.00 0.00 0.00 3.73
2152 2203 6.238157 GCAATTTGCTCACAATCACAAGAAAA 60.238 34.615 14.11 0.00 40.96 2.29
2162 2213 5.131809 ACAATCACAAGAAAATTTTCCCCCA 59.868 36.000 24.01 8.13 37.92 4.96
2196 2248 1.003233 CCCTCTGTTTGTCCACTACCC 59.997 57.143 0.00 0.00 0.00 3.69
2230 2282 5.876651 AAGCAAAAGAAAAAGAGGTCCAT 57.123 34.783 0.00 0.00 0.00 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
208 212 4.263949 ACTCCAAAAAGAGGGTCCTATTGG 60.264 45.833 13.01 13.01 38.26 3.16
500 514 8.504815 GTTTGTTGGATTAGGTCTAACTTTCTC 58.495 37.037 5.99 0.00 45.53 2.87
1165 1203 1.616865 TCCTTGTCGACTTTCCGTGAT 59.383 47.619 17.92 0.00 0.00 3.06
1176 1214 5.581874 GGTTATTAACGGAATTCCTTGTCGA 59.418 40.000 22.05 6.59 0.00 4.20
1337 1375 6.455360 TGCTGATATTGATCCCAAGAAAAC 57.545 37.500 0.00 0.00 35.48 2.43
1775 1820 6.381498 TTCATGTTTACAATCTGGTCCCTA 57.619 37.500 0.00 0.00 0.00 3.53
2152 2203 5.428457 GGAAGAAAATATGGTGGGGGAAAAT 59.572 40.000 0.00 0.00 0.00 1.82
2162 2213 5.536497 AACAGAGGGGAAGAAAATATGGT 57.464 39.130 0.00 0.00 0.00 3.55
2196 2248 3.078837 TCTTTTGCTTAGGTTTAGCCGG 58.921 45.455 0.00 0.00 43.70 6.13


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.