Multiple sequence alignment - TraesCS1D01G182000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G182000 chr1D 100.000 2120 0 0 1 2120 254489716 254487597 0.000000e+00 3916
1 TraesCS1D01G182000 chr1D 95.802 1882 66 7 240 2120 244408393 244406524 0.000000e+00 3025
2 TraesCS1D01G182000 chr1D 95.484 1882 71 8 240 2120 244401942 244400074 0.000000e+00 2992
3 TraesCS1D01G182000 chr1D 94.796 1883 84 7 240 2120 244423930 244422060 0.000000e+00 2922
4 TraesCS1D01G182000 chr2D 98.492 2122 20 4 1 2120 628285682 628283571 0.000000e+00 3731
5 TraesCS1D01G182000 chr2D 97.519 1975 31 9 1 1966 334225937 334223972 0.000000e+00 3360
6 TraesCS1D01G182000 chr6D 98.351 2122 25 5 1 2120 431400041 431397928 0.000000e+00 3716
7 TraesCS1D01G182000 chr3D 98.066 2120 33 4 1 2120 21897569 21895458 0.000000e+00 3681
8 TraesCS1D01G182000 chr2A 97.227 2128 50 3 1 2120 276441059 276443185 0.000000e+00 3594
9 TraesCS1D01G182000 chr2A 97.168 2119 51 4 1 2119 335826294 335824185 0.000000e+00 3572
10 TraesCS1D01G182000 chr2A 87.143 140 10 5 1 139 662230559 662230427 3.640000e-33 152
11 TraesCS1D01G182000 chr3B 97.093 2133 43 5 1 2120 201506593 201504467 0.000000e+00 3578


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G182000 chr1D 254487597 254489716 2119 True 3916 3916 100.000 1 2120 1 chr1D.!!$R4 2119
1 TraesCS1D01G182000 chr1D 244406524 244408393 1869 True 3025 3025 95.802 240 2120 1 chr1D.!!$R2 1880
2 TraesCS1D01G182000 chr1D 244400074 244401942 1868 True 2992 2992 95.484 240 2120 1 chr1D.!!$R1 1880
3 TraesCS1D01G182000 chr1D 244422060 244423930 1870 True 2922 2922 94.796 240 2120 1 chr1D.!!$R3 1880
4 TraesCS1D01G182000 chr2D 628283571 628285682 2111 True 3731 3731 98.492 1 2120 1 chr2D.!!$R2 2119
5 TraesCS1D01G182000 chr2D 334223972 334225937 1965 True 3360 3360 97.519 1 1966 1 chr2D.!!$R1 1965
6 TraesCS1D01G182000 chr6D 431397928 431400041 2113 True 3716 3716 98.351 1 2120 1 chr6D.!!$R1 2119
7 TraesCS1D01G182000 chr3D 21895458 21897569 2111 True 3681 3681 98.066 1 2120 1 chr3D.!!$R1 2119
8 TraesCS1D01G182000 chr2A 276441059 276443185 2126 False 3594 3594 97.227 1 2120 1 chr2A.!!$F1 2119
9 TraesCS1D01G182000 chr2A 335824185 335826294 2109 True 3572 3572 97.168 1 2119 1 chr2A.!!$R1 2118
10 TraesCS1D01G182000 chr3B 201504467 201506593 2126 True 3578 3578 97.093 1 2120 1 chr3B.!!$R1 2119

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
760 799 1.118965 TCTGGAAGCACGGGAGAACA 61.119 55.0 0.0 0.0 0.0 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1934 1987 3.078837 TCTTTTGCTTAGGTTTAGCCGG 58.921 45.455 0.0 0.0 43.7 6.13 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
238 248 4.430423 GCGCTCGCAGTTTGGTCG 62.430 66.667 9.59 0.00 41.49 4.79
760 799 1.118965 TCTGGAAGCACGGGAGAACA 61.119 55.000 0.00 0.00 0.00 3.18
903 942 3.907221 AGTCCTAGGCCAAACGAGTATA 58.093 45.455 5.01 0.00 0.00 1.47
914 953 5.107133 CCAAACGAGTATATCACGGAAAGT 58.893 41.667 0.00 0.00 34.65 2.66
1075 1114 3.181499 CGGACTAGCTGTACCTACTGTTG 60.181 52.174 0.00 0.00 0.00 3.33
1513 1554 7.834881 TTGGGTTCATCTCTATAGTAATCGT 57.165 36.000 0.00 0.00 0.00 3.73
1890 1943 6.238157 GCAATTTGCTCACAATCACAAGAAAA 60.238 34.615 14.11 0.00 40.96 2.29
1900 1953 5.131809 ACAATCACAAGAAAATTTTCCCCCA 59.868 36.000 24.01 8.13 37.92 4.96
1934 1987 1.003233 CCCTCTGTTTGTCCACTACCC 59.997 57.143 0.00 0.00 0.00 3.69
1968 2021 5.876651 AAGCAAAAGAAAAAGAGGTCCAT 57.123 34.783 0.00 0.00 0.00 3.41
2026 2083 8.296713 TCTTTGATGAATTACGAAGAAAAAGGG 58.703 33.333 0.00 0.00 34.75 3.95
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
238 248 8.504815 GTTTGTTGGATTAGGTCTAACTTTCTC 58.495 37.037 5.99 0.00 45.53 2.87
525 563 8.085909 CCTGGTTCCGAAACATAATTACTTTTT 58.914 33.333 0.00 0.00 37.10 1.94
526 564 7.599171 CCTGGTTCCGAAACATAATTACTTTT 58.401 34.615 0.00 0.00 37.10 2.27
903 942 1.616865 TCCTTGTCGACTTTCCGTGAT 59.383 47.619 17.92 0.00 0.00 3.06
914 953 5.581874 GGTTATTAACGGAATTCCTTGTCGA 59.418 40.000 22.05 6.59 0.00 4.20
1075 1114 6.455360 TGCTGATATTGATCCCAAGAAAAC 57.545 37.500 0.00 0.00 35.48 2.43
1513 1554 6.381498 TTCATGTTTACAATCTGGTCCCTA 57.619 37.500 0.00 0.00 0.00 3.53
1890 1943 5.428457 GGAAGAAAATATGGTGGGGGAAAAT 59.572 40.000 0.00 0.00 0.00 1.82
1900 1953 5.536497 AACAGAGGGGAAGAAAATATGGT 57.464 39.130 0.00 0.00 0.00 3.55
1934 1987 3.078837 TCTTTTGCTTAGGTTTAGCCGG 58.921 45.455 0.00 0.00 43.70 6.13
1968 2021 4.770531 TCTTCTTTATTCGGGTCTGTCTCA 59.229 41.667 0.00 0.00 0.00 3.27


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.