Multiple sequence alignment - TraesCS1D01G181900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G181900 chr1D 100.000 2117 0 0 1 2117 254489574 254487458 0.000000e+00 3910
1 TraesCS1D01G181900 chr1D 95.745 2021 71 8 98 2117 244408393 244406387 0.000000e+00 3241
2 TraesCS1D01G181900 chr1D 95.448 2021 77 9 98 2117 244401942 244399936 0.000000e+00 3208
3 TraesCS1D01G181900 chr1D 94.565 2024 92 9 98 2117 244423930 244421921 0.000000e+00 3112
4 TraesCS1D01G181900 chr2D 98.537 2119 21 3 1 2117 628285542 628283432 0.000000e+00 3733
5 TraesCS1D01G181900 chr2D 97.545 1833 30 8 1 1824 334225798 334223972 0.000000e+00 3121
6 TraesCS1D01G181900 chr6D 98.535 2116 25 3 4 2117 431399900 431397789 0.000000e+00 3731
7 TraesCS1D01G181900 chr3D 98.158 2117 36 3 1 2117 21897432 21895319 0.000000e+00 3690
8 TraesCS1D01G181900 chr2A 97.129 2125 52 4 1 2117 276441200 276443323 0.000000e+00 3578
9 TraesCS1D01G181900 chr2A 97.032 1988 50 4 1 1988 335826152 335824174 0.000000e+00 3336
10 TraesCS1D01G181900 chr3B 96.948 2130 46 5 1 2117 201506452 201504329 0.000000e+00 3555
11 TraesCS1D01G181900 chr6B 92.029 138 9 2 1982 2117 566348815 566348678 2.140000e-45 193


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G181900 chr1D 254487458 254489574 2116 True 3910 3910 100.000 1 2117 1 chr1D.!!$R4 2116
1 TraesCS1D01G181900 chr1D 244406387 244408393 2006 True 3241 3241 95.745 98 2117 1 chr1D.!!$R2 2019
2 TraesCS1D01G181900 chr1D 244399936 244401942 2006 True 3208 3208 95.448 98 2117 1 chr1D.!!$R1 2019
3 TraesCS1D01G181900 chr1D 244421921 244423930 2009 True 3112 3112 94.565 98 2117 1 chr1D.!!$R3 2019
4 TraesCS1D01G181900 chr2D 628283432 628285542 2110 True 3733 3733 98.537 1 2117 1 chr2D.!!$R2 2116
5 TraesCS1D01G181900 chr2D 334223972 334225798 1826 True 3121 3121 97.545 1 1824 1 chr2D.!!$R1 1823
6 TraesCS1D01G181900 chr6D 431397789 431399900 2111 True 3731 3731 98.535 4 2117 1 chr6D.!!$R1 2113
7 TraesCS1D01G181900 chr3D 21895319 21897432 2113 True 3690 3690 98.158 1 2117 1 chr3D.!!$R1 2116
8 TraesCS1D01G181900 chr2A 276441200 276443323 2123 False 3578 3578 97.129 1 2117 1 chr2A.!!$F1 2116
9 TraesCS1D01G181900 chr2A 335824174 335826152 1978 True 3336 3336 97.032 1 1988 1 chr2A.!!$R1 1987
10 TraesCS1D01G181900 chr3B 201504329 201506452 2123 True 3555 3555 96.948 1 2117 1 chr3B.!!$R1 2116

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
618 648 1.118965 TCTGGAAGCACGGGAGAACA 61.119 55.0 0.0 0.0 0.0 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1792 1844 3.078837 TCTTTTGCTTAGGTTTAGCCGG 58.921 45.455 0.0 0.0 43.7 6.13 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
96 97 4.430423 GCGCTCGCAGTTTGGTCG 62.430 66.667 9.59 0.00 41.49 4.79
618 648 1.118965 TCTGGAAGCACGGGAGAACA 61.119 55.000 0.00 0.00 0.00 3.18
761 791 3.907221 AGTCCTAGGCCAAACGAGTATA 58.093 45.455 5.01 0.00 0.00 1.47
772 802 5.107133 CCAAACGAGTATATCACGGAAAGT 58.893 41.667 0.00 0.00 34.65 2.66
933 963 3.181499 CGGACTAGCTGTACCTACTGTTG 60.181 52.174 0.00 0.00 0.00 3.33
1371 1402 7.834881 TTGGGTTCATCTCTATAGTAATCGT 57.165 36.000 0.00 0.00 0.00 3.73
1748 1800 6.238157 GCAATTTGCTCACAATCACAAGAAAA 60.238 34.615 14.11 0.00 40.96 2.29
1758 1810 5.131809 ACAATCACAAGAAAATTTTCCCCCA 59.868 36.000 24.01 8.13 37.92 4.96
1792 1844 1.003233 CCCTCTGTTTGTCCACTACCC 59.997 57.143 0.00 0.00 0.00 3.69
1826 1878 5.876651 AAGCAAAAGAAAAAGAGGTCCAT 57.123 34.783 0.00 0.00 0.00 3.41
1884 1940 8.296713 TCTTTGATGAATTACGAAGAAAAAGGG 58.703 33.333 0.00 0.00 34.75 3.95
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
96 97 8.504815 GTTTGTTGGATTAGGTCTAACTTTCTC 58.495 37.037 5.99 0.00 45.53 2.87
761 791 1.616865 TCCTTGTCGACTTTCCGTGAT 59.383 47.619 17.92 0.00 0.00 3.06
772 802 5.581874 GGTTATTAACGGAATTCCTTGTCGA 59.418 40.000 22.05 6.59 0.00 4.20
933 963 6.455360 TGCTGATATTGATCCCAAGAAAAC 57.545 37.500 0.00 0.00 35.48 2.43
1371 1402 6.381498 TTCATGTTTACAATCTGGTCCCTA 57.619 37.500 0.00 0.00 0.00 3.53
1748 1800 5.428457 GGAAGAAAATATGGTGGGGGAAAAT 59.572 40.000 0.00 0.00 0.00 1.82
1758 1810 5.536497 AACAGAGGGGAAGAAAATATGGT 57.464 39.130 0.00 0.00 0.00 3.55
1792 1844 3.078837 TCTTTTGCTTAGGTTTAGCCGG 58.921 45.455 0.00 0.00 43.70 6.13
1826 1878 4.770531 TCTTCTTTATTCGGGTCTGTCTCA 59.229 41.667 0.00 0.00 0.00 3.27


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.