Multiple sequence alignment - TraesCS1D01G181800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G181800 chr1D 100.000 2144 0 0 1 2144 254489353 254487210 0.000000e+00 3960
1 TraesCS1D01G181800 chr1D 95.198 2145 74 11 1 2144 244408269 244406153 0.000000e+00 3363
2 TraesCS1D01G181800 chr1D 94.779 2145 83 12 1 2144 244401818 244399702 0.000000e+00 3314
3 TraesCS1D01G181800 chr1D 94.134 2148 95 11 1 2144 244423806 244421686 0.000000e+00 3240
4 TraesCS1D01G181800 chr2D 98.462 2146 23 3 1 2144 628285321 628283184 0.000000e+00 3771
5 TraesCS1D01G181800 chr3D 98.181 2144 37 2 1 2144 21897212 21895071 0.000000e+00 3742
6 TraesCS1D01G181800 chr6D 98.403 2067 27 3 1 2065 431399682 431397620 0.000000e+00 3629
7 TraesCS1D01G181800 chr2A 97.165 2152 52 4 1 2144 276441421 276443571 0.000000e+00 3627
8 TraesCS1D01G181800 chr3B 96.894 2157 47 6 1 2144 201506231 201504082 0.000000e+00 3594
9 TraesCS1D01G181800 chr3B 98.765 162 2 0 1983 2144 10276122 10276283 2.690000e-74 289
10 TraesCS1D01G181800 chr1A 97.714 1925 34 2 225 2144 554465601 554467520 0.000000e+00 3302


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G181800 chr1D 254487210 254489353 2143 True 3960 3960 100.000 1 2144 1 chr1D.!!$R4 2143
1 TraesCS1D01G181800 chr1D 244406153 244408269 2116 True 3363 3363 95.198 1 2144 1 chr1D.!!$R2 2143
2 TraesCS1D01G181800 chr1D 244399702 244401818 2116 True 3314 3314 94.779 1 2144 1 chr1D.!!$R1 2143
3 TraesCS1D01G181800 chr1D 244421686 244423806 2120 True 3240 3240 94.134 1 2144 1 chr1D.!!$R3 2143
4 TraesCS1D01G181800 chr2D 628283184 628285321 2137 True 3771 3771 98.462 1 2144 1 chr2D.!!$R1 2143
5 TraesCS1D01G181800 chr3D 21895071 21897212 2141 True 3742 3742 98.181 1 2144 1 chr3D.!!$R1 2143
6 TraesCS1D01G181800 chr6D 431397620 431399682 2062 True 3629 3629 98.403 1 2065 1 chr6D.!!$R1 2064
7 TraesCS1D01G181800 chr2A 276441421 276443571 2150 False 3627 3627 97.165 1 2144 1 chr2A.!!$F1 2143
8 TraesCS1D01G181800 chr3B 201504082 201506231 2149 True 3594 3594 96.894 1 2144 1 chr3B.!!$R1 2143
9 TraesCS1D01G181800 chr1A 554465601 554467520 1919 False 3302 3302 97.714 225 2144 1 chr1A.!!$F1 1919

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
397 414 1.118965 TCTGGAAGCACGGGAGAACA 61.119 55.0 0.0 0.0 0.0 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1571 1603 3.078837 TCTTTTGCTTAGGTTTAGCCGG 58.921 45.455 0.0 0.0 43.7 6.13 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
397 414 1.118965 TCTGGAAGCACGGGAGAACA 61.119 55.000 0.00 0.00 0.00 3.18
540 557 3.907221 AGTCCTAGGCCAAACGAGTATA 58.093 45.455 5.01 0.00 0.00 1.47
551 568 5.107133 CCAAACGAGTATATCACGGAAAGT 58.893 41.667 0.00 0.00 34.65 2.66
712 729 3.181499 CGGACTAGCTGTACCTACTGTTG 60.181 52.174 0.00 0.00 0.00 3.33
1150 1168 7.834881 TTGGGTTCATCTCTATAGTAATCGT 57.165 36.000 0.00 0.00 0.00 3.73
1527 1559 6.238157 GCAATTTGCTCACAATCACAAGAAAA 60.238 34.615 14.11 0.00 40.96 2.29
1537 1569 5.131809 ACAATCACAAGAAAATTTTCCCCCA 59.868 36.000 24.01 8.13 37.92 4.96
1571 1603 1.003233 CCCTCTGTTTGTCCACTACCC 59.997 57.143 0.00 0.00 0.00 3.69
1605 1637 5.876651 AAGCAAAAGAAAAAGAGGTCCAT 57.123 34.783 0.00 0.00 0.00 3.41
1663 1699 8.296713 TCTTTGATGAATTACGAAGAAAAAGGG 58.703 33.333 0.00 0.00 34.75 3.95
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
162 179 8.085909 CCTGGTTCCGAAACATAATTACTTTTT 58.914 33.333 0.00 0.00 37.10 1.94
163 180 7.599171 CCTGGTTCCGAAACATAATTACTTTT 58.401 34.615 0.00 0.00 37.10 2.27
164 181 6.349860 GCCTGGTTCCGAAACATAATTACTTT 60.350 38.462 0.00 0.00 37.10 2.66
165 182 5.124936 GCCTGGTTCCGAAACATAATTACTT 59.875 40.000 0.00 0.00 37.10 2.24
166 183 4.638865 GCCTGGTTCCGAAACATAATTACT 59.361 41.667 0.00 0.00 37.10 2.24
540 557 1.616865 TCCTTGTCGACTTTCCGTGAT 59.383 47.619 17.92 0.00 0.00 3.06
551 568 5.581874 GGTTATTAACGGAATTCCTTGTCGA 59.418 40.000 22.05 6.59 0.00 4.20
712 729 6.455360 TGCTGATATTGATCCCAAGAAAAC 57.545 37.500 0.00 0.00 35.48 2.43
1150 1168 6.381498 TTCATGTTTACAATCTGGTCCCTA 57.619 37.500 0.00 0.00 0.00 3.53
1527 1559 5.428457 GGAAGAAAATATGGTGGGGGAAAAT 59.572 40.000 0.00 0.00 0.00 1.82
1537 1569 5.536497 AACAGAGGGGAAGAAAATATGGT 57.464 39.130 0.00 0.00 0.00 3.55
1571 1603 3.078837 TCTTTTGCTTAGGTTTAGCCGG 58.921 45.455 0.00 0.00 43.70 6.13
1605 1637 4.770531 TCTTCTTTATTCGGGTCTGTCTCA 59.229 41.667 0.00 0.00 0.00 3.27
1951 1990 4.524053 GAAATGAATTTCTAGGTCCCGGT 58.476 43.478 0.00 0.00 42.12 5.28


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.