Multiple sequence alignment - TraesCS1D01G181700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G181700 chr1D 100.000 2558 0 0 1 2558 254483518 254486075 0.000000e+00 4724
1 TraesCS1D01G181700 chr1D 96.091 1100 37 3 236 1331 244402968 244404065 0.000000e+00 1788
2 TraesCS1D01G181700 chr1D 95.593 953 31 9 1608 2558 244419597 244420540 0.000000e+00 1517
3 TraesCS1D01G181700 chr1D 95.173 953 36 8 1608 2558 244397626 244398570 0.000000e+00 1496
4 TraesCS1D01G181700 chr1D 94.963 953 36 8 1608 2558 244404065 244405007 0.000000e+00 1483
5 TraesCS1D01G181700 chr5D 97.261 2592 35 11 1 2558 6217661 6215072 0.000000e+00 4361
6 TraesCS1D01G181700 chr5D 97.382 1910 28 5 669 2558 6213200 6211293 0.000000e+00 3230
7 TraesCS1D01G181700 chr5D 97.741 1815 25 4 439 2247 6213191 6214995 0.000000e+00 3110
8 TraesCS1D01G181700 chr5D 98.510 1745 20 4 819 2558 483800946 483799203 0.000000e+00 3073
9 TraesCS1D01G181700 chr6D 96.998 2598 35 11 1 2558 431397375 431394781 0.000000e+00 4325
10 TraesCS1D01G181700 chr1A 97.700 2174 27 5 408 2558 554470848 554468675 0.000000e+00 3716
11 TraesCS1D01G181700 chr1A 97.333 225 5 1 1 224 554472053 554471829 5.160000e-102 381
12 TraesCS1D01G181700 chr3B 97.559 2171 29 6 409 2558 201500761 201502928 0.000000e+00 3694
13 TraesCS1D01G181700 chr3B 96.381 829 8 4 1752 2558 460163427 460162599 0.000000e+00 1345
14 TraesCS1D01G181700 chr2D 98.234 1925 19 7 1 1912 643859882 643861804 0.000000e+00 3352
15 TraesCS1D01G181700 chr2D 96.980 1424 12 6 1156 2558 628280690 628282103 0.000000e+00 2362
16 TraesCS1D01G181700 chr2D 94.241 382 3 3 1 363 628289442 628289061 1.330000e-157 566
17 TraesCS1D01G181700 chr7A 91.800 1561 81 16 1012 2546 710799160 710800699 0.000000e+00 2130
18 TraesCS1D01G181700 chr7A 91.451 386 28 3 1383 1768 664243664 664243284 2.250000e-145 525
19 TraesCS1D01G181700 chrUn 98.496 1064 15 1 415 1477 444441717 444442780 0.000000e+00 1875
20 TraesCS1D01G181700 chrUn 97.140 874 5 5 1 854 443804585 443803712 0.000000e+00 1458
21 TraesCS1D01G181700 chrUn 94.906 373 1 3 94 449 445362034 445362405 3.690000e-158 568
22 TraesCS1D01G181700 chrUn 96.691 272 2 1 106 370 109818792 109818521 1.810000e-121 446
23 TraesCS1D01G181700 chrUn 99.111 225 1 1 1 224 446839272 446839048 1.100000e-108 403
24 TraesCS1D01G181700 chr5A 94.152 513 24 4 1338 1846 666716987 666717497 0.000000e+00 776
25 TraesCS1D01G181700 chr3A 96.889 225 6 1 1 224 435414510 435414286 2.400000e-100 375


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G181700 chr1D 254483518 254486075 2557 False 4724.0 4724 100.0000 1 2558 1 chr1D.!!$F3 2557
1 TraesCS1D01G181700 chr1D 244402968 244405007 2039 False 1635.5 1788 95.5270 236 2558 2 chr1D.!!$F4 2322
2 TraesCS1D01G181700 chr1D 244419597 244420540 943 False 1517.0 1517 95.5930 1608 2558 1 chr1D.!!$F2 950
3 TraesCS1D01G181700 chr1D 244397626 244398570 944 False 1496.0 1496 95.1730 1608 2558 1 chr1D.!!$F1 950
4 TraesCS1D01G181700 chr5D 6211293 6217661 6368 True 3795.5 4361 97.3215 1 2558 2 chr5D.!!$R2 2557
5 TraesCS1D01G181700 chr5D 6213191 6214995 1804 False 3110.0 3110 97.7410 439 2247 1 chr5D.!!$F1 1808
6 TraesCS1D01G181700 chr5D 483799203 483800946 1743 True 3073.0 3073 98.5100 819 2558 1 chr5D.!!$R1 1739
7 TraesCS1D01G181700 chr6D 431394781 431397375 2594 True 4325.0 4325 96.9980 1 2558 1 chr6D.!!$R1 2557
8 TraesCS1D01G181700 chr1A 554468675 554472053 3378 True 2048.5 3716 97.5165 1 2558 2 chr1A.!!$R1 2557
9 TraesCS1D01G181700 chr3B 201500761 201502928 2167 False 3694.0 3694 97.5590 409 2558 1 chr3B.!!$F1 2149
10 TraesCS1D01G181700 chr3B 460162599 460163427 828 True 1345.0 1345 96.3810 1752 2558 1 chr3B.!!$R1 806
11 TraesCS1D01G181700 chr2D 643859882 643861804 1922 False 3352.0 3352 98.2340 1 1912 1 chr2D.!!$F2 1911
12 TraesCS1D01G181700 chr2D 628280690 628282103 1413 False 2362.0 2362 96.9800 1156 2558 1 chr2D.!!$F1 1402
13 TraesCS1D01G181700 chr7A 710799160 710800699 1539 False 2130.0 2130 91.8000 1012 2546 1 chr7A.!!$F1 1534
14 TraesCS1D01G181700 chrUn 444441717 444442780 1063 False 1875.0 1875 98.4960 415 1477 1 chrUn.!!$F1 1062
15 TraesCS1D01G181700 chrUn 443803712 443804585 873 True 1458.0 1458 97.1400 1 854 1 chrUn.!!$R2 853
16 TraesCS1D01G181700 chr5A 666716987 666717497 510 False 776.0 776 94.1520 1338 1846 1 chr5A.!!$F1 508

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
911 1723 6.6076 TCATATGAGTACTAGTTGCTGAAGGT 59.392 38.462 0.0 0.0 0.0 3.5 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1957 2809 3.355626 TCATTCGCTGACTCTATTCCG 57.644 47.619 0.0 0.0 0.0 4.3 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
911 1723 6.607600 TCATATGAGTACTAGTTGCTGAAGGT 59.392 38.462 0.00 0.0 0.00 3.50
1320 2140 5.219633 GGAATAGTGTGCATTTTTCGTTGT 58.780 37.500 0.00 0.0 0.00 3.32
1342 2162 5.187687 GTGGATTCCCTGGAATAAAACGTA 58.812 41.667 11.31 0.0 43.98 3.57
1443 2263 5.915744 TTCTTTATATGGAAATCCGGGGA 57.084 39.130 0.00 0.0 39.43 4.81
1610 2441 9.676195 GAAGAAAAGAAGAATTGGAAGAAGAAG 57.324 33.333 0.00 0.0 0.00 2.85
1708 2539 3.336138 AGGAAGGAACAAACGAGGATC 57.664 47.619 0.00 0.0 0.00 3.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
889 1701 5.949952 TCACCTTCAGCAACTAGTACTCATA 59.050 40.000 0.00 0.00 0.00 2.15
891 1703 4.149598 TCACCTTCAGCAACTAGTACTCA 58.850 43.478 0.00 0.00 0.00 3.41
1177 1993 4.096003 CACGACCCCCTGCGGAAT 62.096 66.667 0.00 0.00 0.00 3.01
1320 2140 4.310022 ACGTTTTATTCCAGGGAATCCA 57.690 40.909 16.48 3.13 43.04 3.41
1342 2162 1.187087 AGGAATCGAAGGAAGACGCT 58.813 50.000 0.00 0.00 0.00 5.07
1527 2348 2.080693 TCAATTGGTACGCGCAAGAAT 58.919 42.857 5.73 0.00 43.02 2.40
1610 2441 2.143925 CTCCCCGTGTTGAGAAAACTC 58.856 52.381 0.00 0.00 0.00 3.01
1732 2565 8.709386 ATGCGATATATCTCACTTGGATAAAC 57.291 34.615 7.54 0.00 30.78 2.01
1957 2809 3.355626 TCATTCGCTGACTCTATTCCG 57.644 47.619 0.00 0.00 0.00 4.30
2214 3069 5.630415 TCCCTTTTATCATCTCGTCCAAT 57.370 39.130 0.00 0.00 0.00 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.