Multiple sequence alignment - TraesCS1D01G181600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G181600 chr1D 100.000 3103 0 0 1 3103 254482020 254478918 0.000000e+00 5731.0
1 TraesCS1D01G181600 chr1D 97.521 1694 38 3 1410 3103 180352115 180353804 0.000000e+00 2892.0
2 TraesCS1D01G181600 chr5D 98.713 3108 31 7 1 3103 483802733 483805836 0.000000e+00 5509.0
3 TraesCS1D01G181600 chr5D 98.143 1992 31 4 1115 3103 6232320 6234308 0.000000e+00 3469.0
4 TraesCS1D01G181600 chr3B 97.554 3107 61 9 1 3103 201498038 201494943 0.000000e+00 5302.0
5 TraesCS1D01G181600 chr2D 98.725 2589 24 7 1 2585 643858384 643855801 0.000000e+00 4590.0
6 TraesCS1D01G181600 chr2D 98.516 2358 25 5 1 2355 359629856 359632206 0.000000e+00 4152.0
7 TraesCS1D01G181600 chr2D 97.933 1693 24 6 1 1689 628291473 628293158 0.000000e+00 2922.0
8 TraesCS1D01G181600 chr2B 97.138 2690 55 9 1 2686 474939887 474937216 0.000000e+00 4521.0
9 TraesCS1D01G181600 chr2B 96.689 151 5 0 2682 2832 474928181 474928031 5.140000e-63 252.0
10 TraesCS1D01G181600 chr2B 98.198 111 2 0 2642 2752 86511654 86511764 8.780000e-46 195.0
11 TraesCS1D01G181600 chr2B 97.222 108 2 1 263 370 84725508 84725614 6.840000e-42 182.0
12 TraesCS1D01G181600 chr2B 94.521 73 4 0 2788 2860 234517285 234517213 2.530000e-21 113.0
13 TraesCS1D01G181600 chr2B 98.148 54 0 1 355 408 700452467 700452415 3.290000e-15 93.5
14 TraesCS1D01G181600 chr7A 93.791 2722 147 15 387 3103 352292166 352294870 0.000000e+00 4071.0
15 TraesCS1D01G181600 chr6D 95.232 2433 93 13 649 3078 210720972 210723384 0.000000e+00 3829.0
16 TraesCS1D01G181600 chr4A 95.975 1913 62 9 1 1907 309270992 309272895 0.000000e+00 3092.0
17 TraesCS1D01G181600 chr3D 95.750 1906 51 9 85 1987 451862319 451864197 0.000000e+00 3044.0
18 TraesCS1D01G181600 chrUn 99.040 1458 12 1 1646 3103 386522344 386523799 0.000000e+00 2614.0
19 TraesCS1D01G181600 chr2A 98.291 234 1 1 2868 3101 771306881 771307111 1.040000e-109 407.0
20 TraesCS1D01G181600 chr2A 97.380 229 6 0 2875 3103 452717035 452717263 1.040000e-104 390.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G181600 chr1D 254478918 254482020 3102 True 5731 5731 100.000 1 3103 1 chr1D.!!$R1 3102
1 TraesCS1D01G181600 chr1D 180352115 180353804 1689 False 2892 2892 97.521 1410 3103 1 chr1D.!!$F1 1693
2 TraesCS1D01G181600 chr5D 483802733 483805836 3103 False 5509 5509 98.713 1 3103 1 chr5D.!!$F2 3102
3 TraesCS1D01G181600 chr5D 6232320 6234308 1988 False 3469 3469 98.143 1115 3103 1 chr5D.!!$F1 1988
4 TraesCS1D01G181600 chr3B 201494943 201498038 3095 True 5302 5302 97.554 1 3103 1 chr3B.!!$R1 3102
5 TraesCS1D01G181600 chr2D 643855801 643858384 2583 True 4590 4590 98.725 1 2585 1 chr2D.!!$R1 2584
6 TraesCS1D01G181600 chr2D 359629856 359632206 2350 False 4152 4152 98.516 1 2355 1 chr2D.!!$F1 2354
7 TraesCS1D01G181600 chr2D 628291473 628293158 1685 False 2922 2922 97.933 1 1689 1 chr2D.!!$F2 1688
8 TraesCS1D01G181600 chr2B 474937216 474939887 2671 True 4521 4521 97.138 1 2686 1 chr2B.!!$R3 2685
9 TraesCS1D01G181600 chr7A 352292166 352294870 2704 False 4071 4071 93.791 387 3103 1 chr7A.!!$F1 2716
10 TraesCS1D01G181600 chr6D 210720972 210723384 2412 False 3829 3829 95.232 649 3078 1 chr6D.!!$F1 2429
11 TraesCS1D01G181600 chr4A 309270992 309272895 1903 False 3092 3092 95.975 1 1907 1 chr4A.!!$F1 1906
12 TraesCS1D01G181600 chr3D 451862319 451864197 1878 False 3044 3044 95.750 85 1987 1 chr3D.!!$F1 1902
13 TraesCS1D01G181600 chrUn 386522344 386523799 1455 False 2614 2614 99.040 1646 3103 1 chrUn.!!$F1 1457

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
532 539 3.037549 TCCTCCACAAAAGGCAAAATGT 58.962 40.909 0.00 0.00 33.65 2.71 F
1057 1069 1.112113 GATTGACACGGGAGCTCCTA 58.888 55.000 31.36 9.17 35.95 2.94 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2100 2120 3.932710 CGCAAGAGCAACATACTTTCCTA 59.067 43.478 0.00 0.0 42.27 2.94 R
2607 2627 0.170116 CTCGTCTGAGAGCGAGCTTT 59.830 55.000 16.92 0.0 46.01 3.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
62 63 9.783256 ATGTTAATTAGGCGTAAATGAAACTTC 57.217 29.630 2.52 0.00 0.00 3.01
449 452 5.885230 TCTTTGTTGACAGCAATCTATGG 57.115 39.130 5.50 0.00 36.22 2.74
455 458 3.609853 TGACAGCAATCTATGGTTCACC 58.390 45.455 0.00 0.00 37.77 4.02
530 537 4.020839 CAGATCCTCCACAAAAGGCAAAAT 60.021 41.667 0.00 0.00 33.65 1.82
531 538 3.749665 TCCTCCACAAAAGGCAAAATG 57.250 42.857 0.00 0.00 33.65 2.32
532 539 3.037549 TCCTCCACAAAAGGCAAAATGT 58.962 40.909 0.00 0.00 33.65 2.71
533 540 4.219115 TCCTCCACAAAAGGCAAAATGTA 58.781 39.130 0.00 0.00 33.65 2.29
715 724 9.451002 TTGATTTGATTTGGCATTATTCAACAT 57.549 25.926 0.00 0.00 0.00 2.71
952 964 5.909610 GCCGATAAGCAAATTAATGTGACTC 59.090 40.000 9.96 0.00 0.00 3.36
953 965 6.458206 GCCGATAAGCAAATTAATGTGACTCA 60.458 38.462 9.96 0.00 0.00 3.41
1057 1069 1.112113 GATTGACACGGGAGCTCCTA 58.888 55.000 31.36 9.17 35.95 2.94
1067 1079 2.393646 GGGAGCTCCTATCAGTGTTCT 58.606 52.381 31.36 0.00 35.95 3.01
1142 1154 6.381498 TGACAATTTGGGTCCTGTAGATAA 57.619 37.500 0.78 0.00 34.36 1.75
2005 2025 6.764560 GCAATTCTTGGCTTGGATGAATTATT 59.235 34.615 0.00 0.00 36.13 1.40
2086 2106 3.428862 CCGTTCTTTGTGGCAGAAGTTTT 60.429 43.478 9.57 0.00 30.72 2.43
2087 2107 4.173256 CGTTCTTTGTGGCAGAAGTTTTT 58.827 39.130 9.57 0.00 30.72 1.94
2607 2627 4.023536 GGTACGAAAGATTTGGTTGAAGCA 60.024 41.667 0.00 0.00 31.50 3.91
2677 2697 4.486839 GATTCCCCCATCCAATTGAAGAT 58.513 43.478 7.12 0.00 0.00 2.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
238 240 6.018016 ACCGTGTTAACTTACCATAACAACAC 60.018 38.462 7.22 0.00 42.00 3.32
837 847 2.097466 CAGCACGGGTCCATAATTTGAC 59.903 50.000 0.00 0.00 0.00 3.18
1057 1069 0.321671 CCACCGACCAGAACACTGAT 59.678 55.000 0.00 0.00 33.94 2.90
1067 1079 0.680280 GAGAGTAGCTCCACCGACCA 60.680 60.000 0.00 0.00 37.69 4.02
1142 1154 4.481368 TGAATAGGGAACGTTGCACTAT 57.519 40.909 21.74 19.68 0.00 2.12
1284 1301 5.047519 TCAGTACTGTTTTACCTACTCCAGC 60.048 44.000 21.99 0.00 0.00 4.85
1594 1612 4.461781 CCTCTGATCCTGCTTGAACAAAAT 59.538 41.667 0.00 0.00 0.00 1.82
2005 2025 4.884668 ACAGTTAAACGATCCTCTTCCA 57.115 40.909 0.00 0.00 0.00 3.53
2086 2106 8.877195 ACATACTTTCCTAGAGAACCAGTAAAA 58.123 33.333 0.00 0.00 33.55 1.52
2087 2107 8.431910 ACATACTTTCCTAGAGAACCAGTAAA 57.568 34.615 0.00 0.00 33.55 2.01
2100 2120 3.932710 CGCAAGAGCAACATACTTTCCTA 59.067 43.478 0.00 0.00 42.27 2.94
2607 2627 0.170116 CTCGTCTGAGAGCGAGCTTT 59.830 55.000 16.92 0.00 46.01 3.51
2777 2797 9.810870 AATCCAATAGTAGGTAAGTAGGTAGAG 57.189 37.037 0.00 0.00 0.00 2.43
2977 2997 5.104259 ACCCCTTTGATCTGTATCTGTTC 57.896 43.478 0.00 0.00 32.93 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.