Multiple sequence alignment - TraesCS1D01G181500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G181500 chr1D 100.000 2216 0 0 1 2216 254478531 254480746 0.000000e+00 4093
1 TraesCS1D01G181500 chr1D 96.990 2093 47 6 1 2081 180354203 180352115 0.000000e+00 3502
2 TraesCS1D01G181500 chr1D 94.795 1902 66 11 1 1888 244210247 244212129 0.000000e+00 2933
3 TraesCS1D01G181500 chr1D 94.648 1906 69 9 1 1892 244790206 244792092 0.000000e+00 2924
4 TraesCS1D01G181500 chr5D 97.622 2229 37 4 1 2216 6234707 6232482 0.000000e+00 3808
5 TraesCS1D01G181500 chr5D 98.349 2059 19 3 170 2216 483806066 483804011 0.000000e+00 3600
6 TraesCS1D01G181500 chr3B 97.576 2228 39 3 1 2216 201494544 201496768 0.000000e+00 3801
7 TraesCS1D01G181500 chr3B 86.816 402 37 1 538 939 197762379 197762764 3.380000e-118 435
8 TraesCS1D01G181500 chr3B 98.404 188 3 0 457 644 817575583 817575396 4.560000e-87 331
9 TraesCS1D01G181500 chr7A 93.888 2225 117 7 1 2213 352295269 352293052 0.000000e+00 3338
10 TraesCS1D01G181500 chr6D 96.231 1804 59 7 413 2216 210723384 210721590 0.000000e+00 2946
11 TraesCS1D01G181500 chr6D 98.980 98 1 0 1 98 45477676 45477579 2.260000e-40 176
12 TraesCS1D01G181500 chrUn 98.997 1595 14 1 251 1845 386523936 386522344 0.000000e+00 2856
13 TraesCS1D01G181500 chrUn 99.052 1371 10 2 597 1967 407031545 407032912 0.000000e+00 2457
14 TraesCS1D01G181500 chrUn 98.929 747 8 0 1 747 397677566 397678312 0.000000e+00 1336
15 TraesCS1D01G181500 chr2D 99.008 1311 10 2 906 2216 643855801 643857108 0.000000e+00 2346
16 TraesCS1D01G181500 chr1A 96.795 624 8 1 1 612 554444945 554444322 0.000000e+00 1031
17 TraesCS1D01G181500 chr7D 93.213 442 19 1 1 431 88617894 88617453 6.670000e-180 640
18 TraesCS1D01G181500 chr7D 98.491 265 4 0 118 382 384948289 384948553 3.330000e-128 468


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G181500 chr1D 254478531 254480746 2215 False 4093 4093 100.000 1 2216 1 chr1D.!!$F3 2215
1 TraesCS1D01G181500 chr1D 180352115 180354203 2088 True 3502 3502 96.990 1 2081 1 chr1D.!!$R1 2080
2 TraesCS1D01G181500 chr1D 244210247 244212129 1882 False 2933 2933 94.795 1 1888 1 chr1D.!!$F1 1887
3 TraesCS1D01G181500 chr1D 244790206 244792092 1886 False 2924 2924 94.648 1 1892 1 chr1D.!!$F2 1891
4 TraesCS1D01G181500 chr5D 6232482 6234707 2225 True 3808 3808 97.622 1 2216 1 chr5D.!!$R1 2215
5 TraesCS1D01G181500 chr5D 483804011 483806066 2055 True 3600 3600 98.349 170 2216 1 chr5D.!!$R2 2046
6 TraesCS1D01G181500 chr3B 201494544 201496768 2224 False 3801 3801 97.576 1 2216 1 chr3B.!!$F2 2215
7 TraesCS1D01G181500 chr7A 352293052 352295269 2217 True 3338 3338 93.888 1 2213 1 chr7A.!!$R1 2212
8 TraesCS1D01G181500 chr6D 210721590 210723384 1794 True 2946 2946 96.231 413 2216 1 chr6D.!!$R2 1803
9 TraesCS1D01G181500 chrUn 386522344 386523936 1592 True 2856 2856 98.997 251 1845 1 chrUn.!!$R1 1594
10 TraesCS1D01G181500 chrUn 407031545 407032912 1367 False 2457 2457 99.052 597 1967 1 chrUn.!!$F2 1370
11 TraesCS1D01G181500 chrUn 397677566 397678312 746 False 1336 1336 98.929 1 747 1 chrUn.!!$F1 746
12 TraesCS1D01G181500 chr2D 643855801 643857108 1307 False 2346 2346 99.008 906 2216 1 chr2D.!!$F1 1310
13 TraesCS1D01G181500 chr1A 554444322 554444945 623 True 1031 1031 96.795 1 612 1 chr1A.!!$R1 611

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
512 554 5.104259 ACCCCTTTGATCTGTATCTGTTC 57.896 43.478 0.0 0.0 32.93 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1403 1447 3.428862 CCGTTCTTTGTGGCAGAAGTTTT 60.429 43.478 9.57 0.0 30.72 2.43 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
219 220 9.778741 TGGATATTTACCTTATCAACTAGCAAG 57.221 33.333 0.0 0.0 0.00 4.01
299 336 5.362430 CAGGCTACTGTTCTCCTATTCTCTT 59.638 44.000 0.0 0.0 39.92 2.85
512 554 5.104259 ACCCCTTTGATCTGTATCTGTTC 57.896 43.478 0.0 0.0 32.93 3.18
712 754 9.810870 AATCCAATAGTAGGTAAGTAGGTAGAG 57.189 37.037 0.0 0.0 0.00 2.43
1389 1433 3.932710 CGCAAGAGCAACATACTTTCCTA 59.067 43.478 0.0 0.0 42.27 2.94
1402 1446 8.431910 ACATACTTTCCTAGAGAACCAGTAAA 57.568 34.615 0.0 0.0 33.55 2.01
1403 1447 8.877195 ACATACTTTCCTAGAGAACCAGTAAAA 58.123 33.333 0.0 0.0 33.55 1.52
1895 1939 4.461781 CCTCTGATCCTGCTTGAACAAAAT 59.538 41.667 0.0 0.0 0.00 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
91 92 7.441836 TGAAGTCTCATAGTTAACTCTTGCAA 58.558 34.615 12.39 0.0 0.00 4.08
219 220 7.175119 GCCTAATCAAATAGAACCCTTATGGAC 59.825 40.741 0.00 0.0 38.00 4.02
812 854 4.486839 GATTCCCCCATCCAATTGAAGAT 58.513 43.478 7.12 0.0 0.00 2.40
1402 1446 4.173256 CGTTCTTTGTGGCAGAAGTTTTT 58.827 39.130 9.57 0.0 30.72 1.94
1403 1447 3.428862 CCGTTCTTTGTGGCAGAAGTTTT 60.429 43.478 9.57 0.0 30.72 2.43


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.