Multiple sequence alignment - TraesCS1D01G181400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G181400 chr1D 100.000 2414 0 0 1 2414 254480760 254478347 0.000000e+00 4458
1 TraesCS1D01G181400 chr1D 97.058 2277 51 6 150 2414 180352115 180354387 0.000000e+00 3819
2 TraesCS1D01G181400 chr1D 94.928 2090 73 9 339 2414 244792092 244790022 0.000000e+00 3241
3 TraesCS1D01G181400 chr1D 94.775 2086 76 11 343 2414 244212129 244210063 0.000000e+00 3217
4 TraesCS1D01G181400 chr5D 97.734 2427 39 4 1 2414 6232468 6234891 0.000000e+00 4163
5 TraesCS1D01G181400 chr5D 98.360 2073 19 3 1 2061 483803997 483806066 0.000000e+00 3626
6 TraesCS1D01G181400 chr3B 97.609 2426 42 4 1 2414 201496782 201494361 0.000000e+00 4145
7 TraesCS1D01G181400 chr3B 96.471 85 3 0 1852 1936 416936783 416936867 9.000000e-30 141
8 TraesCS1D01G181400 chr3B 94.286 70 4 0 1915 1984 6960372 6960303 9.130000e-20 108
9 TraesCS1D01G181400 chr7A 93.820 2427 127 10 2 2414 352293034 352295451 0.000000e+00 3629
10 TraesCS1D01G181400 chr6D 96.256 1816 59 7 3 1818 210721578 210723384 0.000000e+00 2968
11 TraesCS1D01G181400 chrUn 98.997 1595 14 1 386 1980 386522344 386523936 0.000000e+00 2856
12 TraesCS1D01G181400 chrUn 99.052 1371 10 2 264 1634 407032912 407031545 0.000000e+00 2457
13 TraesCS1D01G181400 chrUn 98.926 931 10 0 1484 2414 397678312 397677382 0.000000e+00 1664
14 TraesCS1D01G181400 chr4A 95.544 1773 66 4 643 2414 309286070 309287830 0.000000e+00 2824
15 TraesCS1D01G181400 chr4A 95.192 520 11 5 1908 2414 665560767 665560249 0.000000e+00 809
16 TraesCS1D01G181400 chr2D 99.019 1325 10 2 1 1325 643857122 643855801 0.000000e+00 2372
17 TraesCS1D01G181400 chr1A 96.786 809 12 3 1619 2414 554444322 554445129 0.000000e+00 1338


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G181400 chr1D 254478347 254480760 2413 True 4458 4458 100.000 1 2414 1 chr1D.!!$R3 2413
1 TraesCS1D01G181400 chr1D 180352115 180354387 2272 False 3819 3819 97.058 150 2414 1 chr1D.!!$F1 2264
2 TraesCS1D01G181400 chr1D 244790022 244792092 2070 True 3241 3241 94.928 339 2414 1 chr1D.!!$R2 2075
3 TraesCS1D01G181400 chr1D 244210063 244212129 2066 True 3217 3217 94.775 343 2414 1 chr1D.!!$R1 2071
4 TraesCS1D01G181400 chr5D 6232468 6234891 2423 False 4163 4163 97.734 1 2414 1 chr5D.!!$F1 2413
5 TraesCS1D01G181400 chr5D 483803997 483806066 2069 False 3626 3626 98.360 1 2061 1 chr5D.!!$F2 2060
6 TraesCS1D01G181400 chr3B 201494361 201496782 2421 True 4145 4145 97.609 1 2414 1 chr3B.!!$R2 2413
7 TraesCS1D01G181400 chr7A 352293034 352295451 2417 False 3629 3629 93.820 2 2414 1 chr7A.!!$F1 2412
8 TraesCS1D01G181400 chr6D 210721578 210723384 1806 False 2968 2968 96.256 3 1818 1 chr6D.!!$F1 1815
9 TraesCS1D01G181400 chrUn 386522344 386523936 1592 False 2856 2856 98.997 386 1980 1 chrUn.!!$F1 1594
10 TraesCS1D01G181400 chrUn 407031545 407032912 1367 True 2457 2457 99.052 264 1634 1 chrUn.!!$R2 1370
11 TraesCS1D01G181400 chrUn 397677382 397678312 930 True 1664 1664 98.926 1484 2414 1 chrUn.!!$R1 930
12 TraesCS1D01G181400 chr4A 309286070 309287830 1760 False 2824 2824 95.544 643 2414 1 chr4A.!!$F1 1771
13 TraesCS1D01G181400 chr4A 665560249 665560767 518 True 809 809 95.192 1908 2414 1 chr4A.!!$R1 506
14 TraesCS1D01G181400 chr2D 643855801 643857122 1321 True 2372 2372 99.019 1 1325 1 chr2D.!!$R1 1324
15 TraesCS1D01G181400 chr1A 554444322 554445129 807 False 1338 1338 96.786 1619 2414 1 chr1A.!!$F1 795

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
827 832 4.173256 CGTTCTTTGTGGCAGAAGTTTTT 58.827 39.13 9.57 0.0 30.72 1.94 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1717 1725 5.104259 ACCCCTTTGATCTGTATCTGTTC 57.896 43.478 0.0 0.0 32.93 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
827 832 4.173256 CGTTCTTTGTGGCAGAAGTTTTT 58.827 39.130 9.57 0.0 30.72 1.94
1417 1425 4.486839 GATTCCCCCATCCAATTGAAGAT 58.513 43.478 7.12 0.0 0.00 2.40
2010 2035 7.175119 GCCTAATCAAATAGAACCCTTATGGAC 59.825 40.741 0.00 0.0 38.00 4.02
2138 2163 7.441836 TGAAGTCTCATAGTTAACTCTTGCAA 58.558 34.615 12.39 0.0 0.00 4.08
2243 2268 4.910458 ACACTTTGGTATTGCTCCTAGT 57.090 40.909 0.00 0.0 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
334 338 4.461781 CCTCTGATCCTGCTTGAACAAAAT 59.538 41.667 0.00 0.0 0.00 1.82
827 832 8.431910 ACATACTTTCCTAGAGAACCAGTAAA 57.568 34.615 0.00 0.0 33.55 2.01
840 845 3.932710 CGCAAGAGCAACATACTTTCCTA 59.067 43.478 0.00 0.0 42.27 2.94
1517 1525 9.810870 AATCCAATAGTAGGTAAGTAGGTAGAG 57.189 37.037 0.00 0.0 0.00 2.43
1717 1725 5.104259 ACCCCTTTGATCTGTATCTGTTC 57.896 43.478 0.00 0.0 32.93 3.18
1930 1943 5.362430 CAGGCTACTGTTCTCCTATTCTCTT 59.638 44.000 0.00 0.0 39.92 2.85
2010 2035 9.778741 TGGATATTTACCTTATCAACTAGCAAG 57.221 33.333 0.00 0.0 0.00 4.01
2315 2341 8.777865 CTGATTTAAAGATCAGTTAGTCCACA 57.222 34.615 9.69 0.0 45.08 4.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.