Multiple sequence alignment - TraesCS1D01G181300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G181300 chr1D 100.000 2678 0 0 1 2678 254477631 254474954 0.000000e+00 4946.0
1 TraesCS1D01G181300 chr1D 96.422 2683 77 12 1 2678 244769112 244766444 0.000000e+00 4405.0
2 TraesCS1D01G181300 chr1D 96.194 2680 94 6 1 2678 244201924 244199251 0.000000e+00 4377.0
3 TraesCS1D01G181300 chr1D 96.980 2417 70 3 263 2678 180356024 180358438 0.000000e+00 4056.0
4 TraesCS1D01G181300 chr5D 98.023 2681 48 4 1 2678 6235266 6237944 0.000000e+00 4652.0
5 TraesCS1D01G181300 chr5D 98.538 2394 32 3 287 2678 503331258 503328866 0.000000e+00 4224.0
6 TraesCS1D01G181300 chr1A 98.661 2613 30 5 1 2611 554447312 554449921 0.000000e+00 4626.0
7 TraesCS1D01G181300 chr3B 98.416 2525 36 4 89 2611 201493548 201491026 0.000000e+00 4438.0
8 TraesCS1D01G181300 chr3B 91.176 68 5 1 2612 2678 405424838 405424905 1.020000e-14 91.6
9 TraesCS1D01G181300 chr3B 96.078 51 2 0 2628 2678 729906882 729906932 1.710000e-12 84.2
10 TraesCS1D01G181300 chr2D 98.602 1717 21 3 897 2611 33929969 33931684 0.000000e+00 3035.0
11 TraesCS1D01G181300 chr2D 99.154 1655 13 1 1 1654 648662669 648664323 0.000000e+00 2977.0
12 TraesCS1D01G181300 chr4A 96.930 1759 48 5 921 2678 309374680 309376433 0.000000e+00 2944.0
13 TraesCS1D01G181300 chr7A 94.201 1621 77 5 1 1620 352295826 352297430 0.000000e+00 2457.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G181300 chr1D 254474954 254477631 2677 True 4946 4946 100.000 1 2678 1 chr1D.!!$R3 2677
1 TraesCS1D01G181300 chr1D 244766444 244769112 2668 True 4405 4405 96.422 1 2678 1 chr1D.!!$R2 2677
2 TraesCS1D01G181300 chr1D 244199251 244201924 2673 True 4377 4377 96.194 1 2678 1 chr1D.!!$R1 2677
3 TraesCS1D01G181300 chr1D 180356024 180358438 2414 False 4056 4056 96.980 263 2678 1 chr1D.!!$F1 2415
4 TraesCS1D01G181300 chr5D 6235266 6237944 2678 False 4652 4652 98.023 1 2678 1 chr5D.!!$F1 2677
5 TraesCS1D01G181300 chr5D 503328866 503331258 2392 True 4224 4224 98.538 287 2678 1 chr5D.!!$R1 2391
6 TraesCS1D01G181300 chr1A 554447312 554449921 2609 False 4626 4626 98.661 1 2611 1 chr1A.!!$F1 2610
7 TraesCS1D01G181300 chr3B 201491026 201493548 2522 True 4438 4438 98.416 89 2611 1 chr3B.!!$R1 2522
8 TraesCS1D01G181300 chr2D 33929969 33931684 1715 False 3035 3035 98.602 897 2611 1 chr2D.!!$F1 1714
9 TraesCS1D01G181300 chr2D 648662669 648664323 1654 False 2977 2977 99.154 1 1654 1 chr2D.!!$F2 1653
10 TraesCS1D01G181300 chr4A 309374680 309376433 1753 False 2944 2944 96.930 921 2678 1 chr4A.!!$F1 1757
11 TraesCS1D01G181300 chr7A 352295826 352297430 1604 False 2457 2457 94.201 1 1620 1 chr7A.!!$F1 1619

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1483 1491 7.956508 CGTAAGAAGATATCGCGAGAAATAT 57.043 36.0 16.66 7.37 43.12 1.28 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2503 2515 0.317799 TGCGCGGTACAAAGTTCCTA 59.682 50.0 8.83 0.0 0.0 2.94 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1483 1491 7.956508 CGTAAGAAGATATCGCGAGAAATAT 57.043 36.000 16.66 7.37 43.12 1.28
1485 1493 8.517065 CGTAAGAAGATATCGCGAGAAATATTC 58.483 37.037 16.66 18.87 43.12 1.75
1825 1834 2.744202 GCTAGTCAAACATGAGGTGGTG 59.256 50.000 0.00 0.00 0.00 4.17
2299 2309 6.822442 TCACTTATACAACACAACTCCAGAA 58.178 36.000 0.00 0.00 0.00 3.02
2488 2500 6.968131 TGAACAGAAAAATAGGATGACTCG 57.032 37.500 0.00 0.00 0.00 4.18
2503 2515 5.355910 GGATGACTCGAAGAAGTTCTCTACT 59.644 44.000 5.70 0.00 39.32 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1485 1493 5.425577 TTTGAGATAGAGTTCGATCCTCG 57.574 43.478 6.90 0.0 42.10 4.63
1641 1649 8.762481 ATTTGTAGGAAGGTACTGAACTTTTT 57.238 30.769 0.00 0.0 40.86 1.94
1825 1834 4.581824 TGATCAAAGCCCAAAGATCTATGC 59.418 41.667 0.00 0.0 38.13 3.14
2320 2330 9.833182 GTTTCATCTAGGAAAAGAAGCTAAAAG 57.167 33.333 0.00 0.0 38.41 2.27
2327 2337 7.617041 ATTCCGTTTCATCTAGGAAAAGAAG 57.383 36.000 4.92 0.0 44.71 2.85
2503 2515 0.317799 TGCGCGGTACAAAGTTCCTA 59.682 50.000 8.83 0.0 0.00 2.94
2617 2629 6.014584 GGTGAGATTCCCCTTTATTTGTTTGT 60.015 38.462 0.00 0.0 0.00 2.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.