Multiple sequence alignment - TraesCS1D01G181200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G181200 chr1D 100.000 2216 0 0 1 2216 254476853 254474638 0.000000e+00 4093.0
1 TraesCS1D01G181200 chr1D 97.017 2179 62 3 1 2178 180356539 180358715 0.000000e+00 3661.0
2 TraesCS1D01G181200 chr1D 96.261 2220 65 10 1 2216 244768336 244766131 0.000000e+00 3624.0
3 TraesCS1D01G181200 chr1D 95.986 2217 84 3 1 2216 244201147 244198935 0.000000e+00 3596.0
4 TraesCS1D01G181200 chr1D 100.000 69 0 0 2411 2479 254474443 254474375 7.200000e-26 128.0
5 TraesCS1D01G181200 chr1D 100.000 69 0 0 2411 2479 446749262 446749330 7.200000e-26 128.0
6 TraesCS1D01G181200 chr5D 98.647 2217 29 1 1 2216 503330766 503328550 0.000000e+00 3927.0
7 TraesCS1D01G181200 chr5D 97.971 2218 42 3 1 2216 6236045 6238261 0.000000e+00 3843.0
8 TraesCS1D01G181200 chr5D 97.246 472 12 1 1705 2175 432306160 432306631 0.000000e+00 798.0
9 TraesCS1D01G181200 chr5D 100.000 69 0 0 2411 2479 6238262 6238330 7.200000e-26 128.0
10 TraesCS1D01G181200 chr5D 100.000 69 0 0 2411 2479 365229342 365229274 7.200000e-26 128.0
11 TraesCS1D01G181200 chr5D 100.000 69 0 0 2411 2479 432307098 432307166 7.200000e-26 128.0
12 TraesCS1D01G181200 chr5D 100.000 69 0 0 2411 2479 503328545 503328477 7.200000e-26 128.0
13 TraesCS1D01G181200 chr4A 96.916 2075 58 5 143 2216 309374680 309376749 0.000000e+00 3472.0
14 TraesCS1D01G181200 chr1A 98.528 1834 24 3 1 1833 554448090 554449921 0.000000e+00 3234.0
15 TraesCS1D01G181200 chr3B 98.311 1835 28 3 1 1833 201492859 201491026 0.000000e+00 3214.0
16 TraesCS1D01G181200 chr2D 98.602 1717 21 3 119 1833 33929969 33931684 0.000000e+00 3035.0
17 TraesCS1D01G181200 chr2D 99.522 209 1 0 1 209 573706729 573706937 5.000000e-102 381.0
18 TraesCS1D01G181200 chr2D 98.611 72 1 0 2145 2216 502454960 502455031 7.200000e-26 128.0
19 TraesCS1D01G181200 chr2D 97.872 47 1 0 1 47 648661108 648661154 5.680000e-12 82.4
20 TraesCS1D01G181200 chrUn 97.993 897 11 2 1321 2216 406223886 406224776 0.000000e+00 1550.0
21 TraesCS1D01G181200 chrUn 100.000 69 0 0 2411 2479 406224777 406224845 7.200000e-26 128.0
22 TraesCS1D01G181200 chrUn 100.000 69 0 0 2411 2479 429254513 429254581 7.200000e-26 128.0
23 TraesCS1D01G181200 chrUn 100.000 69 0 0 2411 2479 432962855 432962923 7.200000e-26 128.0
24 TraesCS1D01G181200 chr3A 97.912 479 10 0 1738 2216 431321846 431321368 0.000000e+00 830.0
25 TraesCS1D01G181200 chr2A 98.515 202 2 1 1 202 134517238 134517038 3.030000e-94 355.0
26 TraesCS1D01G181200 chr4B 97.521 121 3 0 10 130 188548400 188548520 8.990000e-50 207.0
27 TraesCS1D01G181200 chr7D 100.000 69 0 0 2411 2479 231550459 231550527 7.200000e-26 128.0
28 TraesCS1D01G181200 chr5B 98.592 71 1 0 2146 2216 174746617 174746687 2.590000e-25 126.0
29 TraesCS1D01G181200 chr5B 98.485 66 1 0 81 146 50524576 50524641 1.560000e-22 117.0
30 TraesCS1D01G181200 chr7B 100.000 56 0 0 2161 2216 119433854 119433799 1.210000e-18 104.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G181200 chr1D 254474375 254476853 2478 True 2110.5 4093 100.0000 1 2479 2 chr1D.!!$R3 2478
1 TraesCS1D01G181200 chr1D 180356539 180358715 2176 False 3661.0 3661 97.0170 1 2178 1 chr1D.!!$F1 2177
2 TraesCS1D01G181200 chr1D 244766131 244768336 2205 True 3624.0 3624 96.2610 1 2216 1 chr1D.!!$R2 2215
3 TraesCS1D01G181200 chr1D 244198935 244201147 2212 True 3596.0 3596 95.9860 1 2216 1 chr1D.!!$R1 2215
4 TraesCS1D01G181200 chr5D 503328477 503330766 2289 True 2027.5 3927 99.3235 1 2479 2 chr5D.!!$R2 2478
5 TraesCS1D01G181200 chr5D 6236045 6238330 2285 False 1985.5 3843 98.9855 1 2479 2 chr5D.!!$F1 2478
6 TraesCS1D01G181200 chr5D 432306160 432307166 1006 False 463.0 798 98.6230 1705 2479 2 chr5D.!!$F2 774
7 TraesCS1D01G181200 chr4A 309374680 309376749 2069 False 3472.0 3472 96.9160 143 2216 1 chr4A.!!$F1 2073
8 TraesCS1D01G181200 chr1A 554448090 554449921 1831 False 3234.0 3234 98.5280 1 1833 1 chr1A.!!$F1 1832
9 TraesCS1D01G181200 chr3B 201491026 201492859 1833 True 3214.0 3214 98.3110 1 1833 1 chr3B.!!$R1 1832
10 TraesCS1D01G181200 chr2D 33929969 33931684 1715 False 3035.0 3035 98.6020 119 1833 1 chr2D.!!$F1 1714
11 TraesCS1D01G181200 chrUn 406223886 406224845 959 False 839.0 1550 98.9965 1321 2479 2 chrUn.!!$F3 1158

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
38 39 4.508662 TGTTGTTTTTGATGTGGAAACCC 58.491 39.13 0.0 0.0 33.49 4.11 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1725 1734 0.317799 TGCGCGGTACAAAGTTCCTA 59.682 50.0 8.83 0.0 0.0 2.94 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
38 39 4.508662 TGTTGTTTTTGATGTGGAAACCC 58.491 39.130 0.00 0.00 33.49 4.11
705 710 7.956508 CGTAAGAAGATATCGCGAGAAATAT 57.043 36.000 16.66 7.37 43.12 1.28
707 712 8.517065 CGTAAGAAGATATCGCGAGAAATATTC 58.483 37.037 16.66 18.87 43.12 1.75
1047 1053 2.744202 GCTAGTCAAACATGAGGTGGTG 59.256 50.000 0.00 0.00 0.00 4.17
1521 1528 6.822442 TCACTTATACAACACAACTCCAGAA 58.178 36.000 0.00 0.00 0.00 3.02
1710 1719 6.968131 TGAACAGAAAAATAGGATGACTCG 57.032 37.500 0.00 0.00 0.00 4.18
1725 1734 5.355910 GGATGACTCGAAGAAGTTCTCTACT 59.644 44.000 5.70 0.00 39.32 2.57
2027 2044 8.202461 AGGTATTTGGATCAATACCTATTCGA 57.798 34.615 25.42 0.00 45.30 3.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
38 39 4.503714 TTGCCCAAGGGTATAGAAAGAG 57.496 45.455 7.05 0.0 37.65 2.85
707 712 5.425577 TTTGAGATAGAGTTCGATCCTCG 57.574 43.478 6.90 0.0 42.10 4.63
863 868 8.762481 ATTTGTAGGAAGGTACTGAACTTTTT 57.238 30.769 0.00 0.0 40.86 1.94
1047 1053 4.581824 TGATCAAAGCCCAAAGATCTATGC 59.418 41.667 0.00 0.0 38.13 3.14
1542 1549 9.833182 GTTTCATCTAGGAAAAGAAGCTAAAAG 57.167 33.333 0.00 0.0 38.41 2.27
1549 1556 7.617041 ATTCCGTTTCATCTAGGAAAAGAAG 57.383 36.000 4.92 0.0 44.71 2.85
1725 1734 0.317799 TGCGCGGTACAAAGTTCCTA 59.682 50.000 8.83 0.0 0.00 2.94
1839 1848 6.014584 GGTGAGATTCCCCTTTATTTGTTTGT 60.015 38.462 0.00 0.0 0.00 2.83
2041 2483 1.202330 ATCTGGTTCCTGGCAGAGAG 58.798 55.000 17.94 0.0 0.00 3.20


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.