Multiple sequence alignment - TraesCS1D01G181100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G181100 chr1D 100.000 4204 0 0 1 4204 254466986 254462783 0.000000e+00 7764.0
1 TraesCS1D01G181100 chr1D 96.762 4169 109 13 1 4167 180378668 180382812 0.000000e+00 6927.0
2 TraesCS1D01G181100 chr1A 98.479 4208 52 7 1 4202 554489606 554485405 0.000000e+00 7406.0
3 TraesCS1D01G181100 chr5D 98.121 4205 69 6 1 4203 6245697 6249893 0.000000e+00 7319.0
4 TraesCS1D01G181100 chr5D 98.168 4204 58 10 1 4203 503347009 503342824 0.000000e+00 7319.0
5 TraesCS1D01G181100 chr5D 98.001 4203 67 11 1 4201 503321074 503316887 0.000000e+00 7280.0
6 TraesCS1D01G181100 chr7B 97.955 4205 72 8 1 4202 662747493 662751686 0.000000e+00 7276.0
7 TraesCS1D01G181100 chr7B 96.552 58 2 0 4145 4202 638054661 638054604 3.460000e-16 97.1
8 TraesCS1D01G181100 chr1B 97.741 4205 78 10 1 4202 633724576 633720386 0.000000e+00 7223.0
9 TraesCS1D01G181100 chr3A 98.287 3852 58 4 354 4202 105549730 105553576 0.000000e+00 6741.0
10 TraesCS1D01G181100 chr7A 96.698 3543 96 11 663 4203 537834507 537838030 0.000000e+00 5875.0
11 TraesCS1D01G181100 chr7A 94.414 734 39 2 1 733 352353687 352354419 0.000000e+00 1127.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G181100 chr1D 254462783 254466986 4203 True 7764 7764 100.000 1 4204 1 chr1D.!!$R1 4203
1 TraesCS1D01G181100 chr1D 180378668 180382812 4144 False 6927 6927 96.762 1 4167 1 chr1D.!!$F1 4166
2 TraesCS1D01G181100 chr1A 554485405 554489606 4201 True 7406 7406 98.479 1 4202 1 chr1A.!!$R1 4201
3 TraesCS1D01G181100 chr5D 6245697 6249893 4196 False 7319 7319 98.121 1 4203 1 chr5D.!!$F1 4202
4 TraesCS1D01G181100 chr5D 503342824 503347009 4185 True 7319 7319 98.168 1 4203 1 chr5D.!!$R2 4202
5 TraesCS1D01G181100 chr5D 503316887 503321074 4187 True 7280 7280 98.001 1 4201 1 chr5D.!!$R1 4200
6 TraesCS1D01G181100 chr7B 662747493 662751686 4193 False 7276 7276 97.955 1 4202 1 chr7B.!!$F1 4201
7 TraesCS1D01G181100 chr1B 633720386 633724576 4190 True 7223 7223 97.741 1 4202 1 chr1B.!!$R1 4201
8 TraesCS1D01G181100 chr3A 105549730 105553576 3846 False 6741 6741 98.287 354 4202 1 chr3A.!!$F1 3848
9 TraesCS1D01G181100 chr7A 537834507 537838030 3523 False 5875 5875 96.698 663 4203 1 chr7A.!!$F2 3540
10 TraesCS1D01G181100 chr7A 352353687 352354419 732 False 1127 1127 94.414 1 733 1 chr7A.!!$F1 732

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
565 570 2.230992 TCAATTGGAAAATGCAGTCGGG 59.769 45.455 5.42 0.0 0.00 5.14 F
1680 1688 0.105913 GGTTGGGACCCCTTTTGACA 60.106 55.000 8.45 0.0 40.25 3.58 F
2480 2492 0.107848 CGGGTCGAAGCCTATGGTTT 60.108 55.000 0.00 0.0 32.48 3.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2480 2492 0.394216 CAGCATTCAACCATCCGGGA 60.394 55.000 0.00 0.0 41.15 5.14 R
2796 2808 1.066257 CGTTGCCCTGCCATAATGC 59.934 57.895 0.00 0.0 0.00 3.56 R
3488 3506 4.157656 CGGTAGGGATTGCAATTTTTCTCA 59.842 41.667 14.33 0.0 0.00 3.27 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
314 318 4.340617 TCCATTAGGAACCGCAGATTTTT 58.659 39.130 0.00 0.00 42.23 1.94
421 426 6.457663 CGTTTGATACCCGATAAAGCAAATCA 60.458 38.462 0.00 0.00 0.00 2.57
475 480 3.370527 CGAGGGGGAACATGTCAAGTATT 60.371 47.826 0.00 0.00 0.00 1.89
547 552 6.885952 TTCGGTAGTCATTTTCCATTTCAA 57.114 33.333 0.00 0.00 0.00 2.69
565 570 2.230992 TCAATTGGAAAATGCAGTCGGG 59.769 45.455 5.42 0.00 0.00 5.14
636 642 2.952310 GGAAACTTTGCACAGAGTTCCT 59.048 45.455 22.21 6.72 35.08 3.36
784 790 9.180678 CTTCAGTTTAATGTTTTTATTCAGCGT 57.819 29.630 0.00 0.00 0.00 5.07
1140 1146 9.319223 GAAGAACGTCTTTATCAGAACATTTTC 57.681 33.333 0.00 0.00 36.73 2.29
1141 1147 8.378172 AGAACGTCTTTATCAGAACATTTTCA 57.622 30.769 0.00 0.00 33.72 2.69
1680 1688 0.105913 GGTTGGGACCCCTTTTGACA 60.106 55.000 8.45 0.00 40.25 3.58
1700 1708 5.887598 TGACAGGTCAATGGAATCTTTATGG 59.112 40.000 0.00 0.00 36.53 2.74
2246 2258 7.118723 TGGCAAGAATGTTAGACCATAAAGAT 58.881 34.615 0.00 0.00 0.00 2.40
2480 2492 0.107848 CGGGTCGAAGCCTATGGTTT 60.108 55.000 0.00 0.00 32.48 3.27
2721 2733 4.299586 TGTGATATTTCTGCTTGGGACA 57.700 40.909 0.00 0.00 0.00 4.02
2736 2748 4.963318 TGGGACACATTTTATTTGGCAA 57.037 36.364 0.00 0.00 0.00 4.52
2796 2808 8.417780 TTTTTATTGGCATTGGAAACATATCG 57.582 30.769 0.00 0.00 42.32 2.92
2886 2898 9.535878 GAGATTACCTATGGTTAAACTCTTCAG 57.464 37.037 0.00 0.00 37.09 3.02
2932 2944 6.385649 TTTTGGGATGAATAGTTTATCGGC 57.614 37.500 0.00 0.00 0.00 5.54
3103 3115 2.747855 GCCCGTGGCTCTTTCCAG 60.748 66.667 7.58 0.00 46.69 3.86
3242 3256 3.784701 ACTGTATCAGCACCTAGTTCG 57.215 47.619 0.00 0.00 34.37 3.95
3616 3634 3.240069 CGGACACGTACTTCGAGAAATT 58.760 45.455 0.00 0.00 42.86 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
314 318 6.778834 AATGCATGAATGTGATGGACTAAA 57.221 33.333 0.00 0.0 0.00 1.85
421 426 2.509052 GCAAGGAAAGCGAAAACCTT 57.491 45.000 0.00 0.0 42.49 3.50
475 480 1.281867 AGAAAACATGATCCCAGGCGA 59.718 47.619 0.00 0.0 0.00 5.54
547 552 1.545582 CACCCGACTGCATTTTCCAAT 59.454 47.619 0.00 0.0 0.00 3.16
565 570 6.646267 TGATCACTTATAGTACCCCAAACAC 58.354 40.000 0.00 0.0 0.00 3.32
636 642 3.623960 CGAAGCCACCCATTAATCGTAAA 59.376 43.478 0.00 0.0 0.00 2.01
784 790 2.156098 GTTCTTGCCAATAACCACGGA 58.844 47.619 0.00 0.0 0.00 4.69
1140 1146 4.616835 GCTAATTGCCCAAAGTGAGAAGTG 60.617 45.833 0.00 0.0 35.15 3.16
1141 1147 3.507622 GCTAATTGCCCAAAGTGAGAAGT 59.492 43.478 0.00 0.0 35.15 3.01
1248 1254 3.132111 TCGCATGAGCAATAGGTCTTACA 59.868 43.478 0.00 0.0 42.66 2.41
1680 1688 4.218312 GGCCATAAAGATTCCATTGACCT 58.782 43.478 0.00 0.0 0.00 3.85
1700 1708 1.534729 ACTCGAATCAGGGTTTTGGC 58.465 50.000 0.00 0.0 0.00 4.52
2055 2065 7.500992 TGAATGCATAAGGAGGTAAAGAGTAG 58.499 38.462 0.00 0.0 0.00 2.57
2246 2258 7.391554 GCCCAACTTAAATGAGATATGATAGCA 59.608 37.037 0.00 0.0 0.00 3.49
2480 2492 0.394216 CAGCATTCAACCATCCGGGA 60.394 55.000 0.00 0.0 41.15 5.14
2721 2733 8.732531 CATCCAGAAAATTGCCAAATAAAATGT 58.267 29.630 0.00 0.0 0.00 2.71
2736 2748 8.485392 CCCAATGGTATTTAACATCCAGAAAAT 58.515 33.333 0.00 0.0 33.33 1.82
2796 2808 1.066257 CGTTGCCCTGCCATAATGC 59.934 57.895 0.00 0.0 0.00 3.56
2932 2944 2.036958 TAAGAACATCCACGCCCATG 57.963 50.000 0.00 0.0 0.00 3.66
3103 3115 2.129607 CAACCAATCTTGCTTGCACAC 58.870 47.619 0.00 0.0 0.00 3.82
3439 3454 7.458397 TCAAGGGAGAAACTTTGCTTCTTATA 58.542 34.615 0.00 0.0 33.24 0.98
3488 3506 4.157656 CGGTAGGGATTGCAATTTTTCTCA 59.842 41.667 14.33 0.0 0.00 3.27
3616 3634 4.515944 CCCGGTAACAAACACTCATAAACA 59.484 41.667 0.00 0.0 0.00 2.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.