Multiple sequence alignment - TraesCS1D01G181000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G181000 chr1D 100.000 3515 0 0 1 3515 254460215 254463729 0.000000e+00 6492
1 TraesCS1D01G181000 chr1D 96.488 3531 89 13 1 3515 51831159 51827648 0.000000e+00 5801
2 TraesCS1D01G181000 chr1A 97.711 3539 50 11 1 3515 554482817 554486348 0.000000e+00 6058
3 TraesCS1D01G181000 chr3A 97.730 3525 62 8 1 3515 105556151 105552635 0.000000e+00 6050
4 TraesCS1D01G181000 chr5D 97.647 3527 62 8 1 3515 6252470 6248953 0.000000e+00 6034
5 TraesCS1D01G181000 chr5D 97.563 3529 63 10 1 3515 503314305 503317824 0.000000e+00 6019
6 TraesCS1D01G181000 chr5D 98.415 1893 16 5 1 1880 299971188 299969297 0.000000e+00 3317
7 TraesCS1D01G181000 chr7A 96.088 3528 104 15 1 3515 537840605 537837099 0.000000e+00 5720
8 TraesCS1D01G181000 chr7A 94.907 432 17 2 154 581 591509189 591508759 0.000000e+00 671
9 TraesCS1D01G181000 chr7A 89.796 490 38 8 12 491 710796641 710796154 4.990000e-173 617
10 TraesCS1D01G181000 chr4D 95.973 3526 115 14 1 3515 19901529 19905038 0.000000e+00 5699
11 TraesCS1D01G181000 chr5A 98.229 3105 36 8 1 3093 559031143 559028046 0.000000e+00 5411
12 TraesCS1D01G181000 chr5A 96.585 205 3 1 1 201 167504955 167505159 1.560000e-88 337
13 TraesCS1D01G181000 chr2B 98.181 3079 48 4 440 3515 683728694 683731767 0.000000e+00 5369
14 TraesCS1D01G181000 chr6B 96.066 305 3 4 1 299 450091337 450091036 4.080000e-134 488
15 TraesCS1D01G181000 chr6B 97.990 199 3 1 1 198 14897224 14897026 9.340000e-91 344
16 TraesCS1D01G181000 chr7B 94.020 301 15 2 3215 3515 179284277 179283980 1.490000e-123 453
17 TraesCS1D01G181000 chr1B 94.231 208 10 1 1 208 427650199 427649994 2.040000e-82 316
18 TraesCS1D01G181000 chr3D 96.407 167 4 2 3267 3431 46201052 46201218 1.240000e-69 274


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G181000 chr1D 254460215 254463729 3514 False 6492 6492 100.000 1 3515 1 chr1D.!!$F1 3514
1 TraesCS1D01G181000 chr1D 51827648 51831159 3511 True 5801 5801 96.488 1 3515 1 chr1D.!!$R1 3514
2 TraesCS1D01G181000 chr1A 554482817 554486348 3531 False 6058 6058 97.711 1 3515 1 chr1A.!!$F1 3514
3 TraesCS1D01G181000 chr3A 105552635 105556151 3516 True 6050 6050 97.730 1 3515 1 chr3A.!!$R1 3514
4 TraesCS1D01G181000 chr5D 6248953 6252470 3517 True 6034 6034 97.647 1 3515 1 chr5D.!!$R1 3514
5 TraesCS1D01G181000 chr5D 503314305 503317824 3519 False 6019 6019 97.563 1 3515 1 chr5D.!!$F1 3514
6 TraesCS1D01G181000 chr5D 299969297 299971188 1891 True 3317 3317 98.415 1 1880 1 chr5D.!!$R2 1879
7 TraesCS1D01G181000 chr7A 537837099 537840605 3506 True 5720 5720 96.088 1 3515 1 chr7A.!!$R1 3514
8 TraesCS1D01G181000 chr4D 19901529 19905038 3509 False 5699 5699 95.973 1 3515 1 chr4D.!!$F1 3514
9 TraesCS1D01G181000 chr5A 559028046 559031143 3097 True 5411 5411 98.229 1 3093 1 chr5A.!!$R1 3092
10 TraesCS1D01G181000 chr2B 683728694 683731767 3073 False 5369 5369 98.181 440 3515 1 chr2B.!!$F1 3075

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
899 941 0.252513 TTCTCGGGTCCCTGGAATGA 60.253 55.000 6.29 0.00 0.00 2.57 F
1442 1484 3.129287 TGTTCCGTATACGAACCTCTTCC 59.871 47.826 26.37 6.09 43.02 3.46 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2122 2165 3.609853 TGCTAGCTACTTGTTTCATGGG 58.390 45.455 17.23 0.0 0.00 4.00 R
3413 3462 3.005261 AGCAACGACACATTATGGCAAAA 59.995 39.130 0.00 0.0 35.12 2.44 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
899 941 0.252513 TTCTCGGGTCCCTGGAATGA 60.253 55.000 6.29 0.00 0.00 2.57
914 956 9.408648 TCCCTGGAATGAAAGAGATAATTAAAC 57.591 33.333 0.00 0.00 0.00 2.01
1046 1088 5.811399 ATTCATAAAATTCTCCGCGAACA 57.189 34.783 8.23 0.00 33.72 3.18
1159 1201 8.642935 TGGTGAAATAATGTCAGGTGAATTAA 57.357 30.769 0.00 0.00 0.00 1.40
1360 1402 3.756082 AACCTATTGATGGGAAAGGCA 57.244 42.857 0.00 0.00 32.04 4.75
1375 1417 5.453339 GGGAAAGGCAAAATTATAGCTTCCC 60.453 44.000 15.06 15.06 42.09 3.97
1420 1462 5.440610 CTGCTCCAAGTATAATTTCCAGGT 58.559 41.667 0.00 0.00 0.00 4.00
1442 1484 3.129287 TGTTCCGTATACGAACCTCTTCC 59.871 47.826 26.37 6.09 43.02 3.46
2065 2108 4.641396 TCTATTCAATGCCGGAATTCGAT 58.359 39.130 4.04 4.88 42.43 3.59
2122 2165 2.540973 GGATCCGCGGCTCAAATTAAAC 60.541 50.000 28.44 6.59 0.00 2.01
2140 2183 8.644374 AATTAAACCCATGAAACAAGTAGCTA 57.356 30.769 0.00 0.00 0.00 3.32
3155 3201 4.515944 CCCGGTAACAAACACTCATAAACA 59.484 41.667 0.00 0.00 0.00 2.83
3283 3329 4.157656 CGGTAGGGATTGCAATTTTTCTCA 59.842 41.667 14.33 0.00 0.00 3.27
3332 3378 7.458397 TCAAGGGAGAAACTTTGCTTCTTATA 58.542 34.615 0.00 0.00 33.24 0.98
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
556 598 3.449632 GTCCCTCTACGCAATTCTTCTC 58.550 50.000 0.00 0.00 0.00 2.87
914 956 8.794335 AAAGTAGAAGTTCAAGGCCTAATTAG 57.206 34.615 5.16 5.43 0.00 1.73
1159 1201 5.888161 CCCTAGTACCTTCTGCAAATTTGAT 59.112 40.000 22.31 0.50 0.00 2.57
1162 1204 4.044191 ACCCCTAGTACCTTCTGCAAATTT 59.956 41.667 0.00 0.00 0.00 1.82
1360 1402 6.064717 AGCGAGATTGGGAAGCTATAATTTT 58.935 36.000 0.00 0.00 36.28 1.82
1375 1417 6.656945 CAGGAGATTCAATTAAGCGAGATTG 58.343 40.000 0.00 3.52 35.18 2.67
1420 1462 3.129287 GGAAGAGGTTCGTATACGGAACA 59.871 47.826 23.22 2.18 36.92 3.18
1529 1571 5.363868 AGAATTGTATCTGTGGCTACTGCTA 59.636 40.000 0.64 0.00 39.59 3.49
2065 2108 5.995282 CAGAAATACCCACATTAATAGCGGA 59.005 40.000 0.00 0.00 0.00 5.54
2122 2165 3.609853 TGCTAGCTACTTGTTTCATGGG 58.390 45.455 17.23 0.00 0.00 4.00
2140 2183 5.163513 CGCTAGTTCCAATTTTGATTTGCT 58.836 37.500 0.00 0.00 0.00 3.91
3155 3201 3.240069 CGGACACGTACTTCGAGAAATT 58.760 45.455 0.00 0.00 42.86 1.82
3413 3462 3.005261 AGCAACGACACATTATGGCAAAA 59.995 39.130 0.00 0.00 35.12 2.44


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.