Multiple sequence alignment - TraesCS1D01G180800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G180800 chr1D 100.000 2246 0 0 1 2246 254458073 254460318 0 4148
1 TraesCS1D01G180800 chr1D 96.810 2257 50 11 1 2246 51833303 51831058 0 3749
2 TraesCS1D01G180800 chr3A 97.922 2262 26 10 1 2246 105558305 105556049 0 3897
3 TraesCS1D01G180800 chr7B 97.830 2258 32 8 1 2246 662756377 662754125 0 3882
4 TraesCS1D01G180800 chr5D 97.829 2257 34 9 1 2246 503338095 503340347 0 3882
5 TraesCS1D01G180800 chr5D 97.395 2265 36 9 1 2246 6254628 6252368 0 3834
6 TraesCS1D01G180800 chr5D 97.253 2257 42 8 1 2246 503312160 503314407 0 3807
7 TraesCS1D01G180800 chr5D 98.167 2182 23 8 69 2238 299973782 299971606 0 3792
8 TraesCS1D01G180800 chr5B 97.700 2261 33 9 1 2246 57516471 57514215 0 3869
9 TraesCS1D01G180800 chr1B 97.652 2257 36 9 1 2246 633715629 633717879 0 3858


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G180800 chr1D 254458073 254460318 2245 False 4148 4148 100.000 1 2246 1 chr1D.!!$F1 2245
1 TraesCS1D01G180800 chr1D 51831058 51833303 2245 True 3749 3749 96.810 1 2246 1 chr1D.!!$R1 2245
2 TraesCS1D01G180800 chr3A 105556049 105558305 2256 True 3897 3897 97.922 1 2246 1 chr3A.!!$R1 2245
3 TraesCS1D01G180800 chr7B 662754125 662756377 2252 True 3882 3882 97.830 1 2246 1 chr7B.!!$R1 2245
4 TraesCS1D01G180800 chr5D 503338095 503340347 2252 False 3882 3882 97.829 1 2246 1 chr5D.!!$F2 2245
5 TraesCS1D01G180800 chr5D 6252368 6254628 2260 True 3834 3834 97.395 1 2246 1 chr5D.!!$R1 2245
6 TraesCS1D01G180800 chr5D 503312160 503314407 2247 False 3807 3807 97.253 1 2246 1 chr5D.!!$F1 2245
7 TraesCS1D01G180800 chr5D 299971606 299973782 2176 True 3792 3792 98.167 69 2238 1 chr5D.!!$R2 2169
8 TraesCS1D01G180800 chr5B 57514215 57516471 2256 True 3869 3869 97.700 1 2246 1 chr5B.!!$R1 2245
9 TraesCS1D01G180800 chr1B 633715629 633717879 2250 False 3858 3858 97.652 1 2246 1 chr1B.!!$F1 2245

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
263 264 3.386486 TCGCTTAGCTTTCGACTTTTCA 58.614 40.909 1.76 0.0 0.0 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1644 1691 6.363896 GGACGAACAAAGAACAAAGTTTTTCA 59.636 34.615 0.0 0.0 0.0 2.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
178 179 6.917217 AAAGGATTGAGCTATTTCGAGAAG 57.083 37.500 0.00 0.0 0.00 2.85
263 264 3.386486 TCGCTTAGCTTTCGACTTTTCA 58.614 40.909 1.76 0.0 0.00 2.69
362 363 8.801299 TCATGTTTCTTGGATTATTTACAAGCA 58.199 29.630 0.00 0.0 40.93 3.91
363 364 9.590451 CATGTTTCTTGGATTATTTACAAGCAT 57.410 29.630 0.00 0.0 40.93 3.79
703 719 5.464168 CAGGTTTCCACTTTAAGCAATGAG 58.536 41.667 0.00 0.0 0.00 2.90
932 956 3.389656 ACTTCTCCCCAATAGAGCTTAGC 59.610 47.826 0.00 0.0 0.00 3.09
1644 1691 1.641577 GGCGAGCGAAGTAAGTGATT 58.358 50.000 0.00 0.0 0.00 2.57
1814 1862 4.532834 ACTGTAGTGGTTGGTGTTTTGAT 58.467 39.130 0.00 0.0 0.00 2.57
1815 1863 4.953579 ACTGTAGTGGTTGGTGTTTTGATT 59.046 37.500 0.00 0.0 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
19 20 2.076863 CAAGGTAAAAGAGCACCCGAG 58.923 52.381 0.00 0.0 35.25 4.63
72 73 3.945981 TTATATCATTCGTGGGCGCTA 57.054 42.857 7.64 0.0 38.14 4.26
263 264 7.633789 ACTAATTCATCCGCCAATATATTCCT 58.366 34.615 0.00 0.0 0.00 3.36
362 363 9.709495 TGTTGCAAAAATAAGAGCTTGAATAAT 57.291 25.926 0.00 0.0 0.00 1.28
363 364 9.709495 ATGTTGCAAAAATAAGAGCTTGAATAA 57.291 25.926 0.00 0.0 0.00 1.40
947 971 9.533831 AAGAAATGGTTAAGGATACAATCAACT 57.466 29.630 0.00 0.0 41.41 3.16
1498 1542 6.648879 TGTTCTGTTCCCAAAATTCCTAAG 57.351 37.500 0.00 0.0 0.00 2.18
1644 1691 6.363896 GGACGAACAAAGAACAAAGTTTTTCA 59.636 34.615 0.00 0.0 0.00 2.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.