Multiple sequence alignment - TraesCS1D01G180600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G180600 chr1D 100.000 2348 0 0 1 2348 254452429 254454776 0 4337
1 TraesCS1D01G180600 chr1D 96.826 1481 39 7 1 1478 51836332 51834857 0 2468
2 TraesCS1D01G180600 chr5D 98.343 2353 33 5 1 2348 6257477 6255126 0 4124
3 TraesCS1D01G180600 chr5D 98.301 2355 31 8 1 2348 503331914 503334266 0 4119
4 TraesCS1D01G180600 chr5D 98.216 2354 30 8 1 2348 503309298 503311645 0 4104
5 TraesCS1D01G180600 chr5D 98.817 1352 12 3 1000 2348 481591752 481593102 0 2405
6 TraesCS1D01G180600 chrUn 98.817 1606 14 4 590 2191 385511363 385509759 0 2856
7 TraesCS1D01G180600 chrUn 98.793 994 8 3 1063 2053 453036188 453035196 0 1766
8 TraesCS1D01G180600 chr1A 98.183 1486 19 5 1 1478 554477865 554479350 0 2588
9 TraesCS1D01G180600 chr1A 99.542 874 3 1 1476 2348 554479524 554480397 0 1591
10 TraesCS1D01G180600 chr6B 97.775 1483 27 6 1 1478 18742659 18741178 0 2551
11 TraesCS1D01G180600 chr1B 97.438 1483 29 7 1 1478 633712593 633714071 0 2519
12 TraesCS1D01G180600 chr1B 98.855 873 9 1 1476 2348 633714245 633715116 0 1555
13 TraesCS1D01G180600 chr4A 96.361 1484 48 6 1 1482 309450772 309449293 0 2436
14 TraesCS1D01G180600 chr3A 99.542 873 4 0 1476 2348 105559693 105558821 0 1591


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G180600 chr1D 254452429 254454776 2347 False 4337.0 4337 100.0000 1 2348 1 chr1D.!!$F1 2347
1 TraesCS1D01G180600 chr1D 51834857 51836332 1475 True 2468.0 2468 96.8260 1 1478 1 chr1D.!!$R1 1477
2 TraesCS1D01G180600 chr5D 6255126 6257477 2351 True 4124.0 4124 98.3430 1 2348 1 chr5D.!!$R1 2347
3 TraesCS1D01G180600 chr5D 503331914 503334266 2352 False 4119.0 4119 98.3010 1 2348 1 chr5D.!!$F3 2347
4 TraesCS1D01G180600 chr5D 503309298 503311645 2347 False 4104.0 4104 98.2160 1 2348 1 chr5D.!!$F2 2347
5 TraesCS1D01G180600 chr5D 481591752 481593102 1350 False 2405.0 2405 98.8170 1000 2348 1 chr5D.!!$F1 1348
6 TraesCS1D01G180600 chrUn 385509759 385511363 1604 True 2856.0 2856 98.8170 590 2191 1 chrUn.!!$R1 1601
7 TraesCS1D01G180600 chrUn 453035196 453036188 992 True 1766.0 1766 98.7930 1063 2053 1 chrUn.!!$R2 990
8 TraesCS1D01G180600 chr1A 554477865 554480397 2532 False 2089.5 2588 98.8625 1 2348 2 chr1A.!!$F1 2347
9 TraesCS1D01G180600 chr6B 18741178 18742659 1481 True 2551.0 2551 97.7750 1 1478 1 chr6B.!!$R1 1477
10 TraesCS1D01G180600 chr1B 633712593 633715116 2523 False 2037.0 2519 98.1465 1 2348 2 chr1B.!!$F1 2347
11 TraesCS1D01G180600 chr4A 309449293 309450772 1479 True 2436.0 2436 96.3610 1 1482 1 chr4A.!!$R1 1481
12 TraesCS1D01G180600 chr3A 105558821 105559693 872 True 1591.0 1591 99.5420 1476 2348 1 chr3A.!!$R1 872

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
982 989 3.630312 ACGCCAAGTAACATCAAAAGTGT 59.37 39.13 0.0 0.0 0.0 3.55 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1969 2333 5.302568 TCAAGATTGCCACATCTCTTTTTGT 59.697 36.0 0.0 0.0 0.0 2.83 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
98 99 6.434028 AGAAGCTATTGGCACTTTGTTGAATA 59.566 34.615 0.00 0.00 44.79 1.75
147 148 3.713858 TTTGTCAGCATCCAACTGTTG 57.286 42.857 13.50 13.50 36.50 3.33
241 242 3.838317 GAGAAATTTTTGGGCCCTTAGGT 59.162 43.478 25.70 3.22 34.57 3.08
715 721 9.302345 GAAAAATCGAGATCTAGTGACATAACA 57.698 33.333 0.00 0.00 0.00 2.41
982 989 3.630312 ACGCCAAGTAACATCAAAAGTGT 59.370 39.130 0.00 0.00 0.00 3.55
1061 1068 1.589113 GAGCAGAACGAGCAGGACT 59.411 57.895 0.00 0.00 0.00 3.85
1151 1158 6.438425 ACCCAAAGTTTCATATCTGAAGCAAT 59.562 34.615 9.73 0.00 43.00 3.56
1315 1324 6.040391 CCCACAAGACAAGAACCTTTATTTCA 59.960 38.462 0.00 0.00 0.00 2.69
1357 1370 4.091424 GCGTCGGAAATGAGAGATTTTTG 58.909 43.478 0.00 0.00 0.00 2.44
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
147 148 8.964420 TGAATTCTTGAATAAACCAATTCGAC 57.036 30.769 7.05 0.0 38.47 4.20
850 857 1.777101 GCTATGGTTAGCTCAGCTCG 58.223 55.000 0.00 0.0 46.13 5.03
1151 1158 5.560966 AACTCGAGCAGTTTCTTGAAAAA 57.439 34.783 13.61 0.0 43.38 1.94
1357 1370 8.794335 AGAAACTAATTCTGTATGGAGAAACC 57.206 34.615 0.00 0.0 46.71 3.27
1598 1962 5.193663 TCCTGCTTCTATCATCTCTTTCG 57.806 43.478 0.00 0.0 0.00 3.46
1969 2333 5.302568 TCAAGATTGCCACATCTCTTTTTGT 59.697 36.000 0.00 0.0 0.00 2.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.