Multiple sequence alignment - TraesCS1D01G180500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G180500 chr1D 100.000 2105 0 0 1 2105 254439969 254442073 0.000000e+00 3888.0
1 TraesCS1D01G180500 chr1D 96.849 1428 21 5 1 1424 51866998 51865591 0.000000e+00 2366.0
2 TraesCS1D01G180500 chr1D 99.381 485 3 0 1 485 491423461 491422977 0.000000e+00 880.0
3 TraesCS1D01G180500 chr5D 98.624 2108 24 4 1 2105 503296835 503298940 0.000000e+00 3727.0
4 TraesCS1D01G180500 chr5D 98.481 2106 29 3 1 2105 6271046 6268943 0.000000e+00 3709.0
5 TraesCS1D01G180500 chr5D 97.437 2107 24 5 1 2105 6171981 6169903 0.000000e+00 3565.0
6 TraesCS1D01G180500 chr5D 99.381 485 3 0 1 485 512414203 512414687 0.000000e+00 880.0
7 TraesCS1D01G180500 chr2D 98.386 2107 25 4 1 2105 638429365 638431464 0.000000e+00 3694.0
8 TraesCS1D01G180500 chr4D 97.102 2105 42 7 1 2105 19873444 19875529 0.000000e+00 3531.0
9 TraesCS1D01G180500 chr4B 96.442 2108 49 12 5 2105 308674835 308672747 0.000000e+00 3454.0
10 TraesCS1D01G180500 chr4B 100.000 36 0 0 2070 2105 429228703 429228668 1.350000e-07 67.6
11 TraesCS1D01G180500 chr4A 97.181 1667 39 2 442 2105 309484656 309482995 0.000000e+00 2811.0
12 TraesCS1D01G180500 chr3D 94.393 1837 61 12 297 2105 235644625 235646447 0.000000e+00 2784.0
13 TraesCS1D01G180500 chr3D 98.059 1185 16 3 805 1988 323520783 323521961 0.000000e+00 2054.0
14 TraesCS1D01G180500 chr7A 95.946 74 2 1 2019 2092 571439213 571439285 3.670000e-23 119.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G180500 chr1D 254439969 254442073 2104 False 3888 3888 100.000 1 2105 1 chr1D.!!$F1 2104
1 TraesCS1D01G180500 chr1D 51865591 51866998 1407 True 2366 2366 96.849 1 1424 1 chr1D.!!$R1 1423
2 TraesCS1D01G180500 chr5D 503296835 503298940 2105 False 3727 3727 98.624 1 2105 1 chr5D.!!$F1 2104
3 TraesCS1D01G180500 chr5D 6268943 6271046 2103 True 3709 3709 98.481 1 2105 1 chr5D.!!$R2 2104
4 TraesCS1D01G180500 chr5D 6169903 6171981 2078 True 3565 3565 97.437 1 2105 1 chr5D.!!$R1 2104
5 TraesCS1D01G180500 chr2D 638429365 638431464 2099 False 3694 3694 98.386 1 2105 1 chr2D.!!$F1 2104
6 TraesCS1D01G180500 chr4D 19873444 19875529 2085 False 3531 3531 97.102 1 2105 1 chr4D.!!$F1 2104
7 TraesCS1D01G180500 chr4B 308672747 308674835 2088 True 3454 3454 96.442 5 2105 1 chr4B.!!$R1 2100
8 TraesCS1D01G180500 chr4A 309482995 309484656 1661 True 2811 2811 97.181 442 2105 1 chr4A.!!$R1 1663
9 TraesCS1D01G180500 chr3D 235644625 235646447 1822 False 2784 2784 94.393 297 2105 1 chr3D.!!$F1 1808
10 TraesCS1D01G180500 chr3D 323520783 323521961 1178 False 2054 2054 98.059 805 1988 1 chr3D.!!$F2 1183

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
918 949 7.02552 AGTATTATCAGAATGCAAGCCCTAT 57.974 36.0 0.0 0.0 34.76 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1796 1841 1.848652 AGTAAGTCTCGCTTGGGCTA 58.151 50.0 0.0 0.0 38.05 3.93 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
918 949 7.025520 AGTATTATCAGAATGCAAGCCCTAT 57.974 36.000 0.00 0.0 34.76 2.57
1623 1668 8.293699 AGTTTCTTACAGGAGTGAAACAAAAT 57.706 30.769 16.29 0.0 46.03 1.82
1931 1976 3.656697 GGGATTCCGCCCTAAGGT 58.343 61.111 0.00 0.0 45.12 3.50
1961 2006 8.186821 GGATCAATCAGTTCAAGGAATTTACTG 58.813 37.037 0.00 0.0 38.00 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
918 949 6.652205 AGGGGTATCTTGTAAATTCAAGGA 57.348 37.500 6.96 0.0 43.25 3.36
1328 1365 6.127535 ACCTGATTGAAATTAAGTGGATGCAG 60.128 38.462 0.00 0.0 0.00 4.41
1796 1841 1.848652 AGTAAGTCTCGCTTGGGCTA 58.151 50.000 0.00 0.0 38.05 3.93
1931 1976 5.440207 TCCTTGAACTGATTGATCCATGA 57.560 39.130 0.00 0.0 0.00 3.07
2056 2101 5.111989 CGCTTCTTCTATTCAGGACATCAA 58.888 41.667 0.00 0.0 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.