Multiple sequence alignment - TraesCS1D01G180400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G180400 chr1D 100.000 2213 0 0 1 2213 254435049 254437261 0.000000e+00 4087.0
1 TraesCS1D01G180400 chr1D 96.706 2216 60 6 1 2213 51871922 51869717 0.000000e+00 3675.0
2 TraesCS1D01G180400 chr2D 98.691 2216 23 6 1 2213 638424520 638426732 0.000000e+00 3927.0
3 TraesCS1D01G180400 chr5D 98.647 2217 25 5 1 2213 503291886 503294101 0.000000e+00 3923.0
4 TraesCS1D01G180400 chr5D 98.014 2215 25 5 1 2213 6176901 6174704 0.000000e+00 3829.0
5 TraesCS1D01G180400 chr5D 98.990 1881 14 4 1 1877 512410200 512412079 0.000000e+00 3363.0
6 TraesCS1D01G180400 chr5D 98.937 1881 14 5 1 1877 512417137 512419015 0.000000e+00 3358.0
7 TraesCS1D01G180400 chr5D 93.661 489 29 2 1725 2213 12935856 12936342 0.000000e+00 730.0
8 TraesCS1D01G180400 chr4B 96.662 2217 64 8 4 2213 308679750 308677537 0.000000e+00 3675.0
9 TraesCS1D01G180400 chr4D 94.542 2217 106 13 1 2213 207068210 207066005 0.000000e+00 3410.0
10 TraesCS1D01G180400 chr1B 97.722 1888 38 5 329 2213 633708037 633709922 0.000000e+00 3243.0
11 TraesCS1D01G180400 chr1B 98.328 299 5 0 1 299 649656074 649656372 1.950000e-145 525.0
12 TraesCS1D01G180400 chr2B 99.225 387 3 0 54 440 90714308 90713922 0.000000e+00 699.0
13 TraesCS1D01G180400 chr3B 100.000 102 0 0 255 356 772233266 772233367 2.900000e-44 189.0
14 TraesCS1D01G180400 chr7D 100.000 35 0 0 304 338 595333533 595333567 5.100000e-07 65.8
15 TraesCS1D01G180400 chr1D 100.000 2213 0 0 1 2213 254435049 254437261 0.000000e+00 4087.0
16 TraesCS1D01G180400 chr1D 96.706 2216 60 6 1 2213 51871922 51869717 0.000000e+00 3675.0
17 TraesCS1D01G180400 chr2D 98.691 2216 23 6 1 2213 638424520 638426732 0.000000e+00 3927.0
18 TraesCS1D01G180400 chr2D 98.137 161 3 0 2053 2213 628294760 628294600 4.650000e-72 281.0
19 TraesCS1D01G180400 chr2D 98.065 155 3 0 2059 2213 84931528 84931682 1.010000e-68 270.0
20 TraesCS1D01G180400 chr2D 99.145 117 1 0 1970 2086 336259376 336259492 6.190000e-51 211.0
21 TraesCS1D01G180400 chr5D 98.647 2217 25 5 1 2213 503291886 503294101 0.000000e+00 3923.0
22 TraesCS1D01G180400 chr5D 98.014 2215 25 5 1 2213 6176901 6174704 0.000000e+00 3829.0
23 TraesCS1D01G180400 chr5D 98.990 1881 14 4 1 1877 512410200 512412079 0.000000e+00 3363.0
24 TraesCS1D01G180400 chr5D 98.937 1881 14 5 1 1877 512417137 512419015 0.000000e+00 3358.0
25 TraesCS1D01G180400 chr4B 96.662 2217 64 8 4 2213 308679750 308677537 0.000000e+00 3675.0
26 TraesCS1D01G180400 chr4D 94.542 2217 106 13 1 2213 207068210 207066005 0.000000e+00 3410.0
27 TraesCS1D01G180400 chr1B 97.722 1888 38 5 329 2213 633708037 633709922 0.000000e+00 3243.0
28 TraesCS1D01G180400 chr3D 94.755 2021 86 12 1 2018 235618899 235620902 0.000000e+00 3127.0
29 TraesCS1D01G180400 chr3D 98.824 85 1 0 1903 1987 326650520 326650604 3.810000e-33 152.0
30 TraesCS1D01G180400 chr7B 94.268 157 9 0 211 367 467522811 467522967 7.900000e-60 241.0
31 TraesCS1D01G180400 chr7B 94.928 138 7 0 1 138 105252635 105252498 1.330000e-52 217.0
32 TraesCS1D01G180400 chr7A 99.206 126 1 0 129 254 17092809 17092934 6.150000e-56 228.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G180400 chr1D 254435049 254437261 2212 False 4087 4087 100.000 1 2213 2 chr1D.!!$F1 2212
1 TraesCS1D01G180400 chr1D 51869717 51871922 2205 True 3675 3675 96.706 1 2213 2 chr1D.!!$R1 2212
2 TraesCS1D01G180400 chr2D 638424520 638426732 2212 False 3927 3927 98.691 1 2213 2 chr2D.!!$F3 2212
3 TraesCS1D01G180400 chr5D 503291886 503294101 2215 False 3923 3923 98.647 1 2213 2 chr5D.!!$F2 2212
4 TraesCS1D01G180400 chr5D 6174704 6176901 2197 True 3829 3829 98.014 1 2213 2 chr5D.!!$R1 2212
5 TraesCS1D01G180400 chr5D 512410200 512412079 1879 False 3363 3363 98.990 1 1877 2 chr5D.!!$F3 1876
6 TraesCS1D01G180400 chr5D 512417137 512419015 1878 False 3358 3358 98.937 1 1877 2 chr5D.!!$F4 1876
7 TraesCS1D01G180400 chr4B 308677537 308679750 2213 True 3675 3675 96.662 4 2213 2 chr4B.!!$R1 2209
8 TraesCS1D01G180400 chr4D 207066005 207068210 2205 True 3410 3410 94.542 1 2213 2 chr4D.!!$R1 2212
9 TraesCS1D01G180400 chr1B 633708037 633709922 1885 False 3243 3243 97.722 329 2213 2 chr1B.!!$F2 1884
10 TraesCS1D01G180400 chr3D 235618899 235620902 2003 False 3127 3127 94.755 1 2018 1 chr3D.!!$F1 2017

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
527 529 7.333323 AGCCATTCATTCCTTTTTATGAAAGG 58.667 34.615 13.5 13.5 45.54 3.11 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2189 2222 0.743345 AAGCTAACGATGCGGGTTCC 60.743 55.0 0.0 0.0 35.28 3.62 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
527 529 7.333323 AGCCATTCATTCCTTTTTATGAAAGG 58.667 34.615 13.50 13.5 45.54 3.11
1078 1087 5.644644 CATTAATTGCAACTTCCTCAGTCC 58.355 41.667 0.00 0.0 32.94 3.85
1825 1842 3.076182 AGAGAGGTAGACTGTCCCTTTCA 59.924 47.826 18.93 0.0 40.23 2.69
2093 2126 4.856789 TCCGCTCTGGAGTACCAA 57.143 55.556 0.00 0.0 46.32 3.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
14 15 6.262056 AGATATTTACCTAAACCTGTGGGG 57.738 41.667 0.00 0.0 41.89 4.96
796 802 2.758979 CGGGTATAGCGGATCCTGTATT 59.241 50.000 10.75 0.0 0.00 1.89
1065 1074 7.674772 ACACTAATTACTAGGACTGAGGAAGTT 59.325 37.037 0.00 0.0 40.07 2.66
1825 1842 9.657419 CTACCCTGCAGAAAATAAAAATGAAAT 57.343 29.630 17.39 0.0 0.00 2.17
2189 2222 0.743345 AAGCTAACGATGCGGGTTCC 60.743 55.000 0.00 0.0 35.28 3.62


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.