Multiple sequence alignment - TraesCS1D01G180200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G180200 chr1D 100.000 2111 0 0 1 2111 254416801 254418911 0 3899
1 TraesCS1D01G180200 chr1D 97.037 2126 42 10 1 2111 51878337 51876218 0 3557
2 TraesCS1D01G180200 chr1A 98.114 2121 29 8 1 2111 554458203 554460322 0 3685
3 TraesCS1D01G180200 chr5D 97.703 2133 25 12 1 2111 503287036 503289166 0 3646
4 TraesCS1D01G180200 chr5D 97.319 2126 31 13 1 2111 6181210 6179096 0 3587
5 TraesCS1D01G180200 chr6D 97.650 2128 23 14 1 2111 45511835 45509718 0 3627
6 TraesCS1D01G180200 chr5A 96.832 2115 51 14 1 2111 607200354 607198252 0 3520
7 TraesCS1D01G180200 chr5A 93.222 1372 55 14 1 1349 621863392 621862036 0 1984
8 TraesCS1D01G180200 chr2B 97.569 2057 36 10 60 2111 474900137 474902184 0 3509
9 TraesCS1D01G180200 chr7B 95.646 2113 78 10 1 2111 105256859 105254759 0 3380
10 TraesCS1D01G180200 chr4B 94.964 1529 61 9 587 2111 308683448 308681932 0 2383
11 TraesCS1D01G180200 chr2A 96.493 1055 23 5 1 1045 335830891 335829841 0 1731
12 TraesCS1D01G180200 chr3B 98.120 798 14 1 1 797 101919309 101918512 0 1389


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G180200 chr1D 254416801 254418911 2110 False 3899 3899 100.000 1 2111 1 chr1D.!!$F1 2110
1 TraesCS1D01G180200 chr1D 51876218 51878337 2119 True 3557 3557 97.037 1 2111 1 chr1D.!!$R1 2110
2 TraesCS1D01G180200 chr1A 554458203 554460322 2119 False 3685 3685 98.114 1 2111 1 chr1A.!!$F1 2110
3 TraesCS1D01G180200 chr5D 503287036 503289166 2130 False 3646 3646 97.703 1 2111 1 chr5D.!!$F1 2110
4 TraesCS1D01G180200 chr5D 6179096 6181210 2114 True 3587 3587 97.319 1 2111 1 chr5D.!!$R1 2110
5 TraesCS1D01G180200 chr6D 45509718 45511835 2117 True 3627 3627 97.650 1 2111 1 chr6D.!!$R1 2110
6 TraesCS1D01G180200 chr5A 607198252 607200354 2102 True 3520 3520 96.832 1 2111 1 chr5A.!!$R1 2110
7 TraesCS1D01G180200 chr5A 621862036 621863392 1356 True 1984 1984 93.222 1 1349 1 chr5A.!!$R2 1348
8 TraesCS1D01G180200 chr2B 474900137 474902184 2047 False 3509 3509 97.569 60 2111 1 chr2B.!!$F1 2051
9 TraesCS1D01G180200 chr7B 105254759 105256859 2100 True 3380 3380 95.646 1 2111 1 chr7B.!!$R1 2110
10 TraesCS1D01G180200 chr4B 308681932 308683448 1516 True 2383 2383 94.964 587 2111 1 chr4B.!!$R1 1524
11 TraesCS1D01G180200 chr2A 335829841 335830891 1050 True 1731 1731 96.493 1 1045 1 chr2A.!!$R1 1044
12 TraesCS1D01G180200 chr3B 101918512 101919309 797 True 1389 1389 98.120 1 797 1 chr3B.!!$R1 796

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
334 338 4.911514 TTGGGAAAGTCCGAAGAAAAAG 57.088 40.909 0.0 0.0 37.43 2.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1957 2023 5.864418 AAAAGTAACCCTTCTTTTCCCAC 57.136 39.13 0.0 0.0 38.86 4.61 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
334 338 4.911514 TTGGGAAAGTCCGAAGAAAAAG 57.088 40.909 0.00 0.0 37.43 2.27
694 703 6.596888 AGGGTAAAAGCCGAGAAGTTTTATAC 59.403 38.462 0.00 0.0 41.56 1.47
1116 1151 3.404899 TGGACGCGAGGAGTAAAAATTT 58.595 40.909 15.93 0.0 0.00 1.82
1666 1725 8.720562 CAAATCCACCATAAAATTGGAAAGAAC 58.279 33.333 0.00 0.0 42.71 3.01
1957 2023 2.053244 ACCCATGCAATAGAGAGGGAG 58.947 52.381 0.00 0.0 39.60 4.30
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
334 338 5.411831 AGGAAAAGGCAGATTCAAAATCC 57.588 39.130 0.00 0.0 0.00 3.01
669 678 3.503800 AAACTTCTCGGCTTTTACCCT 57.496 42.857 0.00 0.0 0.00 4.34
733 742 5.914033 TGTAGCTACCCATTCAATGTAGAC 58.086 41.667 21.01 0.0 35.13 2.59
1666 1725 6.608002 AGGAGTCAGGTCTACTTACTTTATGG 59.392 42.308 0.00 0.0 33.88 2.74
1957 2023 5.864418 AAAAGTAACCCTTCTTTTCCCAC 57.136 39.130 0.00 0.0 38.86 4.61


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.