Multiple sequence alignment - TraesCS1D01G180000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G180000 chr1D 100.000 2630 0 0 1 2630 254403766 254401137 0.000000e+00 4857.0
1 TraesCS1D01G180000 chr1D 96.215 2642 63 20 1 2630 51880420 51883036 0.000000e+00 4290.0
2 TraesCS1D01G180000 chr5D 97.616 2643 38 14 1 2630 503284953 503282323 0.000000e+00 4508.0
3 TraesCS1D01G180000 chr5D 97.543 2605 48 10 38 2630 6183317 6185917 0.000000e+00 4442.0
4 TraesCS1D01G180000 chr5D 98.231 2487 28 9 158 2630 483806079 483808563 0.000000e+00 4335.0
5 TraesCS1D01G180000 chr6D 97.389 2643 42 13 1 2630 45513916 45516544 0.000000e+00 4473.0
6 TraesCS1D01G180000 chr2A 96.907 2651 54 14 1 2630 335832978 335835621 0.000000e+00 4416.0
7 TraesCS1D01G180000 chr4A 95.802 2644 76 19 1 2630 309509474 309512096 0.000000e+00 4235.0
8 TraesCS1D01G180000 chr4A 95.568 2640 79 19 3 2630 310732942 310735555 0.000000e+00 4193.0
9 TraesCS1D01G180000 chr4A 90.805 174 7 8 1 174 255829716 255829552 9.470000e-55 224.0
10 TraesCS1D01G180000 chr3D 98.136 2146 18 8 497 2630 598875970 598873835 0.000000e+00 3722.0
11 TraesCS1D01G180000 chr5B 97.533 527 6 1 2111 2630 609898152 609898678 0.000000e+00 894.0
12 TraesCS1D01G180000 chr7B 83.810 105 10 4 82 185 632804873 632804775 2.790000e-15 93.5
13 TraesCS1D01G180000 chr6B 97.143 35 1 0 1 35 262482982 262482948 2.830000e-05 60.2


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G180000 chr1D 254401137 254403766 2629 True 4857 4857 100.000 1 2630 1 chr1D.!!$R1 2629
1 TraesCS1D01G180000 chr1D 51880420 51883036 2616 False 4290 4290 96.215 1 2630 1 chr1D.!!$F1 2629
2 TraesCS1D01G180000 chr5D 503282323 503284953 2630 True 4508 4508 97.616 1 2630 1 chr5D.!!$R1 2629
3 TraesCS1D01G180000 chr5D 6183317 6185917 2600 False 4442 4442 97.543 38 2630 1 chr5D.!!$F1 2592
4 TraesCS1D01G180000 chr5D 483806079 483808563 2484 False 4335 4335 98.231 158 2630 1 chr5D.!!$F2 2472
5 TraesCS1D01G180000 chr6D 45513916 45516544 2628 False 4473 4473 97.389 1 2630 1 chr6D.!!$F1 2629
6 TraesCS1D01G180000 chr2A 335832978 335835621 2643 False 4416 4416 96.907 1 2630 1 chr2A.!!$F1 2629
7 TraesCS1D01G180000 chr4A 309509474 309512096 2622 False 4235 4235 95.802 1 2630 1 chr4A.!!$F1 2629
8 TraesCS1D01G180000 chr4A 310732942 310735555 2613 False 4193 4193 95.568 3 2630 1 chr4A.!!$F2 2627
9 TraesCS1D01G180000 chr3D 598873835 598875970 2135 True 3722 3722 98.136 497 2630 1 chr3D.!!$R1 2133
10 TraesCS1D01G180000 chr5B 609898152 609898678 526 False 894 894 97.533 2111 2630 1 chr5B.!!$F1 519

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
634 644 0.540133 GCGGGGAAAGGTTGGGTTTA 60.54 55.0 0.0 0.0 0.0 2.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1942 1968 0.605319 TCGCGGCTGAGTCCAAAAAT 60.605 50.0 6.13 0.0 0.0 1.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
163 172 3.069443 ACCTGTTCGTTTTGGCATTTGAT 59.931 39.130 0.00 0.0 0.00 2.57
231 240 0.944386 ATGTTTTGACAGAAGCGCGT 59.056 45.000 8.43 0.0 0.00 6.01
402 411 3.008813 TGGTAGAGTCTAGAAGACCACGT 59.991 47.826 7.52 0.0 46.18 4.49
565 575 4.630069 GCAACGAGCTGAACTTCCTAATTA 59.370 41.667 0.00 0.0 41.15 1.40
634 644 0.540133 GCGGGGAAAGGTTGGGTTTA 60.540 55.000 0.00 0.0 0.00 2.01
1206 1225 9.644993 CGTTTAATTATTCGAATGTATCAGCAA 57.355 29.630 20.87 4.6 0.00 3.91
1508 1528 2.770164 ATCCTGGTTCAACTCCTTCG 57.230 50.000 0.00 0.0 0.00 3.79
1790 1812 6.498538 TGGAACATTTTGGGATAATGTACCT 58.501 36.000 0.00 0.0 43.44 3.08
2180 2206 4.099633 CTGGATCAGGGCATCCTATTAGA 58.900 47.826 4.22 0.0 42.67 2.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
66 75 6.476706 CGATGGCCAAATTCTCCTTATTTTTC 59.523 38.462 10.96 0.00 0.00 2.29
207 216 3.423206 GCGCTTCTGTCAAAACATTGAAG 59.577 43.478 0.00 0.00 39.19 3.02
231 240 7.308450 TCCAAAAATCAATGGAATTACACCA 57.692 32.000 0.00 0.00 42.61 4.17
565 575 4.713792 AATTAGAGCGGGGAATCATTCT 57.286 40.909 0.00 0.00 0.00 2.40
634 644 6.402981 AAAATAAAGGGTCCACTCATAGGT 57.597 37.500 0.00 0.00 0.00 3.08
1508 1528 5.209818 TGGAACATCTTGGATACGGTATC 57.790 43.478 17.85 17.85 42.51 2.24
1942 1968 0.605319 TCGCGGCTGAGTCCAAAAAT 60.605 50.000 6.13 0.00 0.00 1.82
2047 2073 5.239359 TGAATTCTCCAGCATTTGATTCG 57.761 39.130 7.05 0.00 0.00 3.34
2099 2125 2.109480 AGTAGCGGGGACTATGGTATCA 59.891 50.000 0.00 0.00 0.00 2.15
2180 2206 7.552050 TGATAAATCTGTCCAAATGGGTTTT 57.448 32.000 0.00 0.00 38.11 2.43


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.