Multiple sequence alignment - TraesCS1D01G179900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G179900 chr1D 100.000 3062 0 0 1 3062 254401710 254398649 0.000000e+00 5655.0
1 TraesCS1D01G179900 chr1D 96.783 1430 36 4 1 1422 51882456 51883883 0.000000e+00 2377.0
2 TraesCS1D01G179900 chr5D 98.502 3070 33 4 1 3062 6185337 6188401 0.000000e+00 5402.0
3 TraesCS1D01G179900 chr5D 98.850 2435 27 1 628 3062 503281198 503278765 0.000000e+00 4340.0
4 TraesCS1D01G179900 chr5D 98.373 1844 24 6 1221 3062 432405875 432404036 0.000000e+00 3234.0
5 TraesCS1D01G179900 chr5D 98.443 1092 10 1 1 1085 503282903 503281812 0.000000e+00 1916.0
6 TraesCS1D01G179900 chr6D 97.656 3072 57 8 1 3060 45515965 45519033 0.000000e+00 5260.0
7 TraesCS1D01G179900 chr2A 97.557 3070 47 5 1 3062 335835040 335838089 0.000000e+00 5228.0
8 TraesCS1D01G179900 chr2A 94.211 190 4 1 1 183 588081782 588081593 1.800000e-72 283.0
9 TraesCS1D01G179900 chr4A 96.460 3079 89 11 1 3062 309511517 309514592 0.000000e+00 5064.0
10 TraesCS1D01G179900 chr4A 95.870 3075 105 12 1 3062 310734975 310738040 0.000000e+00 4955.0
11 TraesCS1D01G179900 chr4B 96.480 3068 83 9 1 3057 308692874 308695927 0.000000e+00 5044.0
12 TraesCS1D01G179900 chr3D 98.633 2121 27 2 942 3062 589282199 589280081 0.000000e+00 3755.0
13 TraesCS1D01G179900 chr5A 97.154 1968 52 4 1097 3062 607271896 607273861 0.000000e+00 3321.0
14 TraesCS1D01G179900 chr5A 96.518 1034 29 1 78 1104 607216288 607217321 0.000000e+00 1703.0
15 TraesCS1D01G179900 chr2B 98.174 931 14 2 2132 3062 474906988 474907915 0.000000e+00 1622.0
16 TraesCS1D01G179900 chr2B 98.673 226 2 1 2590 2814 683349367 683349142 1.710000e-107 399.0
17 TraesCS1D01G179900 chr2B 97.312 186 5 0 2776 2961 102997171 102997356 1.770000e-82 316.0
18 TraesCS1D01G179900 chr2B 94.054 185 4 1 1 178 657475930 657475746 1.080000e-69 274.0
19 TraesCS1D01G179900 chr2B 97.744 133 3 0 1 133 286034198 286034330 2.370000e-56 230.0
20 TraesCS1D01G179900 chr2B 97.581 124 3 0 2938 3061 575861262 575861385 2.390000e-51 213.0
21 TraesCS1D01G179900 chr2B 100.000 56 0 0 2101 2156 755374065 755374120 1.500000e-18 104.0
22 TraesCS1D01G179900 chr2B 96.226 53 2 0 2497 2549 742396360 742396412 1.510000e-13 87.9


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G179900 chr1D 254398649 254401710 3061 True 5655 5655 100.0000 1 3062 1 chr1D.!!$R1 3061
1 TraesCS1D01G179900 chr1D 51882456 51883883 1427 False 2377 2377 96.7830 1 1422 1 chr1D.!!$F1 1421
2 TraesCS1D01G179900 chr5D 6185337 6188401 3064 False 5402 5402 98.5020 1 3062 1 chr5D.!!$F1 3061
3 TraesCS1D01G179900 chr5D 432404036 432405875 1839 True 3234 3234 98.3730 1221 3062 1 chr5D.!!$R1 1841
4 TraesCS1D01G179900 chr5D 503278765 503282903 4138 True 3128 4340 98.6465 1 3062 2 chr5D.!!$R2 3061
5 TraesCS1D01G179900 chr6D 45515965 45519033 3068 False 5260 5260 97.6560 1 3060 1 chr6D.!!$F1 3059
6 TraesCS1D01G179900 chr2A 335835040 335838089 3049 False 5228 5228 97.5570 1 3062 1 chr2A.!!$F1 3061
7 TraesCS1D01G179900 chr4A 309511517 309514592 3075 False 5064 5064 96.4600 1 3062 1 chr4A.!!$F1 3061
8 TraesCS1D01G179900 chr4A 310734975 310738040 3065 False 4955 4955 95.8700 1 3062 1 chr4A.!!$F2 3061
9 TraesCS1D01G179900 chr4B 308692874 308695927 3053 False 5044 5044 96.4800 1 3057 1 chr4B.!!$F1 3056
10 TraesCS1D01G179900 chr3D 589280081 589282199 2118 True 3755 3755 98.6330 942 3062 1 chr3D.!!$R1 2120
11 TraesCS1D01G179900 chr5A 607271896 607273861 1965 False 3321 3321 97.1540 1097 3062 1 chr5A.!!$F2 1965
12 TraesCS1D01G179900 chr5A 607216288 607217321 1033 False 1703 1703 96.5180 78 1104 1 chr5A.!!$F1 1026
13 TraesCS1D01G179900 chr2B 474906988 474907915 927 False 1622 1622 98.1740 2132 3062 1 chr2B.!!$F3 930

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
973 2057 0.320374 CGTGTGCTTGGGAGTCCTTA 59.68 55.0 9.58 0.0 0.0 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2446 3545 6.575162 AAACGAATCCTTTTGTAGCTCATT 57.425 33.333 0.0 0.0 0.0 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
124 126 4.099633 CTGGATCAGGGCATCCTATTAGA 58.900 47.826 4.22 0.0 42.67 2.10
973 2057 0.320374 CGTGTGCTTGGGAGTCCTTA 59.680 55.000 9.58 0.0 0.00 2.69
1087 2171 6.456501 ACTAGCACTGAAAATCGTCTTTACT 58.543 36.000 0.00 0.0 0.00 2.24
1127 2211 8.281531 TGTTTTGATGATCCCTACCTTATTGAT 58.718 33.333 0.00 0.0 0.00 2.57
1198 2286 4.955811 ATTGATGGTATTCGTGAGCCTA 57.044 40.909 0.00 0.0 0.00 3.93
1360 2449 9.944376 ATGAGCTAATTGTTCTACACTTCTTAA 57.056 29.630 0.00 0.0 0.00 1.85
1415 2504 3.949842 ACTTAGTTTCCGTCTGGGTAC 57.050 47.619 0.00 0.0 37.00 3.34
1936 3032 3.508402 TGTAGTTGATAGTCAAGGTCGCA 59.492 43.478 0.00 0.0 37.00 5.10
2408 3507 6.145048 ACCACGTTACTATTGTTTCTTTCTCG 59.855 38.462 0.00 0.0 0.00 4.04
2468 3568 7.865706 ATAATGAGCTACAAAAGGATTCGTT 57.134 32.000 0.00 0.0 0.00 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
43 45 2.109480 AGTAGCGGGGACTATGGTATCA 59.891 50.000 0.00 0.00 0.00 2.15
124 126 7.552050 TGATAAATCTGTCCAAATGGGTTTT 57.448 32.000 0.00 0.00 38.11 2.43
1087 2171 1.604755 CAAAACACCGAACCATCCGAA 59.395 47.619 0.00 0.00 0.00 4.30
1127 2211 6.073980 GGCGATAATAAATACAGAAGTTGCGA 60.074 38.462 0.00 0.00 0.00 5.10
1360 2449 6.013554 ACCCATATAACAAGCTACACCAAT 57.986 37.500 0.00 0.00 0.00 3.16
1415 2504 1.577328 AACAGCAATCCAAGGACGCG 61.577 55.000 3.53 3.53 32.93 6.01
2408 3507 9.620259 AAGATAGAAAAGGTCAATATGAAGGAC 57.380 33.333 0.00 0.00 0.00 3.85
2446 3545 6.575162 AAACGAATCCTTTTGTAGCTCATT 57.425 33.333 0.00 0.00 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.