Multiple sequence alignment - TraesCS1D01G179800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G179800 chr1D 100.000 2216 0 0 1 2216 254398294 254400509 0 4093
1 TraesCS1D01G179800 chr3D 98.872 2216 22 3 1 2216 589279727 589281939 0 3951
2 TraesCS1D01G179800 chr5D 98.827 2217 23 3 1 2216 6188755 6186541 0 3947
3 TraesCS1D01G179800 chr5D 98.782 2216 25 2 1 2216 503278411 503280624 0 3941
4 TraesCS1D01G179800 chr5D 97.954 2199 38 7 1 2197 432403682 432405875 0 3805
5 TraesCS1D01G179800 chr5D 99.130 1265 10 1 1 1265 503218033 503216770 0 2274
6 TraesCS1D01G179800 chr1A 98.481 2173 23 3 1 2172 554512063 554509900 0 3821
7 TraesCS1D01G179800 chr5A 97.295 2218 55 5 1 2216 607274215 607272001 0 3759
8 TraesCS1D01G179800 chr4A 96.806 2223 60 7 3 2216 309514944 309512724 0 3701
9 TraesCS1D01G179800 chr4A 96.027 2240 58 17 1 2216 310738412 310736180 0 3615
10 TraesCS1D01G179800 chr4B 96.395 2219 61 9 1 2216 308696285 308694083 0 3637
11 TraesCS1D01G179800 chr6D 97.805 1868 34 6 354 2216 45519037 45517172 0 3216


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G179800 chr1D 254398294 254400509 2215 False 4093 4093 100.000 1 2216 1 chr1D.!!$F1 2215
1 TraesCS1D01G179800 chr3D 589279727 589281939 2212 False 3951 3951 98.872 1 2216 1 chr3D.!!$F1 2215
2 TraesCS1D01G179800 chr5D 6186541 6188755 2214 True 3947 3947 98.827 1 2216 1 chr5D.!!$R1 2215
3 TraesCS1D01G179800 chr5D 503278411 503280624 2213 False 3941 3941 98.782 1 2216 1 chr5D.!!$F2 2215
4 TraesCS1D01G179800 chr5D 432403682 432405875 2193 False 3805 3805 97.954 1 2197 1 chr5D.!!$F1 2196
5 TraesCS1D01G179800 chr5D 503216770 503218033 1263 True 2274 2274 99.130 1 1265 1 chr5D.!!$R2 1264
6 TraesCS1D01G179800 chr1A 554509900 554512063 2163 True 3821 3821 98.481 1 2172 1 chr1A.!!$R1 2171
7 TraesCS1D01G179800 chr5A 607272001 607274215 2214 True 3759 3759 97.295 1 2216 1 chr5A.!!$R1 2215
8 TraesCS1D01G179800 chr4A 309512724 309514944 2220 True 3701 3701 96.806 3 2216 1 chr4A.!!$R1 2213
9 TraesCS1D01G179800 chr4A 310736180 310738412 2232 True 3615 3615 96.027 1 2216 1 chr4A.!!$R2 2215
10 TraesCS1D01G179800 chr4B 308694083 308696285 2202 True 3637 3637 96.395 1 2216 1 chr4B.!!$R1 2215
11 TraesCS1D01G179800 chr6D 45517172 45519037 1865 True 3216 3216 97.805 354 2216 1 chr6D.!!$R1 1862

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
970 1001 6.575162 AAACGAATCCTTTTGTAGCTCATT 57.425 33.333 0.0 0.0 0.0 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2001 2044 3.949842 ACTTAGTTTCCGTCTGGGTAC 57.05 47.619 0.0 0.0 37.0 3.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
53 72 7.121168 CAGAGACCTAGGATGTAGAAGATCATC 59.879 44.444 17.98 0.00 39.49 2.92
970 1001 6.575162 AAACGAATCCTTTTGTAGCTCATT 57.425 33.333 0.00 0.00 0.00 2.57
1008 1039 9.620259 AAGATAGAAAAGGTCAATATGAAGGAC 57.380 33.333 0.00 0.00 0.00 3.85
2001 2044 1.577328 AACAGCAATCCAAGGACGCG 61.577 55.000 3.53 3.53 32.93 6.01
2056 2099 6.013554 ACCCATATAACAAGCTACACCAAT 57.986 37.500 0.00 0.00 0.00 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
53 72 0.807275 TCTGCCGAATCGCTCATGTG 60.807 55.000 0.00 0.0 0.00 3.21
225 244 6.926272 GCATATCGGTTGAAGTAGATTCTTCT 59.074 38.462 7.72 0.0 42.76 2.85
1008 1039 6.145048 ACCACGTTACTATTGTTTCTTTCTCG 59.855 38.462 0.00 0.0 0.00 4.04
1480 1515 3.508402 TGTAGTTGATAGTCAAGGTCGCA 59.492 43.478 0.00 0.0 37.00 5.10
2001 2044 3.949842 ACTTAGTTTCCGTCTGGGTAC 57.050 47.619 0.00 0.0 37.00 3.34
2056 2099 9.944376 ATGAGCTAATTGTTCTACACTTCTTAA 57.056 29.630 0.00 0.0 0.00 1.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.