Multiple sequence alignment - TraesCS1D01G179700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G179700 chr1D 100.000 3117 0 0 1 3117 254396850 254399966 0 5757
1 TraesCS1D01G179700 chr3D 98.461 3118 42 5 1 3117 589278285 589281397 0 5487
2 TraesCS1D01G179700 chr5D 98.333 3119 48 4 1 3117 6190200 6187084 0 5469
3 TraesCS1D01G179700 chr5D 98.332 3117 49 3 2 3117 503276967 503280081 0 5465
4 TraesCS1D01G179700 chr5D 97.306 3118 76 8 3 3117 432402239 432405351 0 5286
5 TraesCS1D01G179700 chr5D 98.635 2710 35 2 1 2709 503219478 503216770 0 4798
6 TraesCS1D01G179700 chr5A 97.147 3119 83 6 1 3116 607275659 607272544 0 5262
7 TraesCS1D01G179700 chr4A 96.289 3126 103 9 2 3117 309516389 309513267 0 5118
8 TraesCS1D01G179700 chr4B 96.252 3122 96 11 1 3117 308697731 308694626 0 5097
9 TraesCS1D01G179700 chr6D 98.561 2711 36 3 1 2709 168256186 168253477 0 4787
10 TraesCS1D01G179700 chr3B 98.525 2711 36 4 1 2709 201528284 201525576 0 4782
11 TraesCS1D01G179700 chrUn 98.935 657 7 0 2461 3117 239345464 239346120 0 1175
12 TraesCS1D01G179700 chr7B 88.025 785 70 13 2340 3117 719442377 719441610 0 907


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G179700 chr1D 254396850 254399966 3116 False 5757 5757 100.000 1 3117 1 chr1D.!!$F1 3116
1 TraesCS1D01G179700 chr3D 589278285 589281397 3112 False 5487 5487 98.461 1 3117 1 chr3D.!!$F1 3116
2 TraesCS1D01G179700 chr5D 6187084 6190200 3116 True 5469 5469 98.333 1 3117 1 chr5D.!!$R1 3116
3 TraesCS1D01G179700 chr5D 503276967 503280081 3114 False 5465 5465 98.332 2 3117 1 chr5D.!!$F2 3115
4 TraesCS1D01G179700 chr5D 432402239 432405351 3112 False 5286 5286 97.306 3 3117 1 chr5D.!!$F1 3114
5 TraesCS1D01G179700 chr5D 503216770 503219478 2708 True 4798 4798 98.635 1 2709 1 chr5D.!!$R2 2708
6 TraesCS1D01G179700 chr5A 607272544 607275659 3115 True 5262 5262 97.147 1 3116 1 chr5A.!!$R1 3115
7 TraesCS1D01G179700 chr4A 309513267 309516389 3122 True 5118 5118 96.289 2 3117 1 chr4A.!!$R1 3115
8 TraesCS1D01G179700 chr4B 308694626 308697731 3105 True 5097 5097 96.252 1 3117 1 chr4B.!!$R1 3116
9 TraesCS1D01G179700 chr6D 168253477 168256186 2709 True 4787 4787 98.561 1 2709 1 chr6D.!!$R1 2708
10 TraesCS1D01G179700 chr3B 201525576 201528284 2708 True 4782 4782 98.525 1 2709 1 chr3B.!!$R1 2708
11 TraesCS1D01G179700 chrUn 239345464 239346120 656 False 1175 1175 98.935 2461 3117 1 chrUn.!!$F1 656
12 TraesCS1D01G179700 chr7B 719441610 719442377 767 True 907 907 88.025 2340 3117 1 chr7B.!!$R1 777

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
701 704 3.259876 ACCGTAGACAGGCAAGTGAAATA 59.740 43.478 0.0 0.0 0.0 1.40 F
1297 1303 2.764572 GAGAGGAGGACGGGTTATTCAA 59.235 50.000 0.0 0.0 0.0 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2049 2058 4.974645 TTCCTAGTTCTTCTTCCAAGCA 57.025 40.909 0.0 0.0 0.0 3.91 R
2924 2943 3.508402 TGTAGTTGATAGTCAAGGTCGCA 59.492 43.478 0.0 0.0 37.0 5.10 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
79 80 6.829229 ATTTACGATGTACGATGATCCCTA 57.171 37.500 0.00 0.00 45.77 3.53
701 704 3.259876 ACCGTAGACAGGCAAGTGAAATA 59.740 43.478 0.00 0.00 0.00 1.40
820 823 7.490402 GTCATAAGCGCCTATACCGTAAAATAT 59.510 37.037 2.29 0.00 0.00 1.28
969 973 5.485353 CAGAGGGGCTATAATTGGAGATACA 59.515 44.000 0.00 0.00 0.00 2.29
1126 1132 6.183360 CCAATTTGACTACCTCTACGGGATAA 60.183 42.308 0.00 0.00 36.97 1.75
1134 1140 4.296056 ACCTCTACGGGATAAACCTCAAT 58.704 43.478 0.00 0.00 38.98 2.57
1297 1303 2.764572 GAGAGGAGGACGGGTTATTCAA 59.235 50.000 0.00 0.00 0.00 2.69
1329 1335 4.773674 TGATGGTCAGAGGCAAATTGAAAT 59.226 37.500 0.00 0.00 0.00 2.17
1415 1421 9.970395 AATATGTGGAAGTATCGACGTAATTTA 57.030 29.630 0.00 0.00 38.66 1.40
1497 1503 7.121168 CAGAGACCTAGGATGTAGAAGATCATC 59.879 44.444 17.98 0.00 39.49 2.92
2049 2058 1.776267 AACCCCTTGGGGTTATCCTGT 60.776 52.381 34.77 14.71 42.24 4.00
2234 2246 1.171308 CCACTGCCTTGATCCACTTG 58.829 55.000 0.00 0.00 0.00 3.16
2414 2432 6.575162 AAACGAATCCTTTTGTAGCTCATT 57.425 33.333 0.00 0.00 0.00 2.57
2452 2470 9.620259 AAGATAGAAAAGGTCAATATGAAGGAC 57.380 33.333 0.00 0.00 0.00 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
79 80 3.576982 CCATTCAGCCATGGATGCTTAAT 59.423 43.478 25.40 16.37 46.18 1.40
701 704 7.403312 TGGATCAAATTATTTCGTGGATTGT 57.597 32.000 0.00 0.00 0.00 2.71
820 823 6.160684 TGTCTTCTTGATTCCGTCGAAAATA 58.839 36.000 0.00 0.00 0.00 1.40
838 841 7.808856 GGTTACGATTCTACCAGATATGTCTTC 59.191 40.741 0.00 0.00 30.42 2.87
900 903 4.913355 TCACCATCCCCATAATGTATGAGT 59.087 41.667 0.00 0.00 38.45 3.41
909 912 4.007581 TCTCTTCTCACCATCCCCATAA 57.992 45.455 0.00 0.00 0.00 1.90
969 973 7.418337 AGGAACTTTTGTACCAGAAACAATT 57.582 32.000 0.00 0.00 36.75 2.32
1009 1013 1.125711 ACCGCACTCAAAGGTAGGGT 61.126 55.000 0.00 0.00 36.34 4.34
1010 1014 0.036306 AACCGCACTCAAAGGTAGGG 59.964 55.000 0.00 0.00 37.26 3.53
1011 1015 1.535462 CAAACCGCACTCAAAGGTAGG 59.465 52.381 0.00 0.00 37.26 3.18
1134 1140 4.695396 TGCCGTTACTCAACAGTTTTCTA 58.305 39.130 0.00 0.00 34.05 2.10
1297 1303 6.855763 TGCCTCTGACCATCAAATTAAATT 57.144 33.333 0.00 0.00 0.00 1.82
1329 1335 5.104652 GGGGTCTTAATTACCACTGCTTAGA 60.105 44.000 8.85 0.00 37.44 2.10
1497 1503 0.807275 TCTGCCGAATCGCTCATGTG 60.807 55.000 0.00 0.00 0.00 3.21
2049 2058 4.974645 TTCCTAGTTCTTCTTCCAAGCA 57.025 40.909 0.00 0.00 0.00 3.91
2452 2470 6.145048 ACCACGTTACTATTGTTTCTTTCTCG 59.855 38.462 0.00 0.00 0.00 4.04
2924 2943 3.508402 TGTAGTTGATAGTCAAGGTCGCA 59.492 43.478 0.00 0.00 37.00 5.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.