Multiple sequence alignment - TraesCS1D01G179600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G179600 chr1D 100.000 3102 0 0 1 3102 254399860 254396759 0.000000e+00 5729
1 TraesCS1D01G179600 chr3D 98.421 3103 43 5 1 3102 589281291 589278194 0.000000e+00 5454
2 TraesCS1D01G179600 chr5D 98.293 3104 49 4 1 3102 6187190 6190291 0.000000e+00 5435
3 TraesCS1D01G179600 chr5D 98.260 3103 51 3 1 3102 503279975 503276875 0.000000e+00 5428
4 TraesCS1D01G179600 chr5D 97.230 3105 78 8 1 3102 432405245 432402146 0.000000e+00 5251
5 TraesCS1D01G179600 chr5D 98.608 2801 37 2 303 3102 503216770 503219569 0.000000e+00 4955
6 TraesCS1D01G179600 chr5A 97.166 3105 82 6 1 3102 607272649 607275750 0.000000e+00 5241
7 TraesCS1D01G179600 chr2A 96.907 3104 73 6 1 3102 335836898 335839980 0.000000e+00 5179
8 TraesCS1D01G179600 chr4A 96.208 3112 105 9 1 3102 309513373 309516481 0.000000e+00 5081
9 TraesCS1D01G179600 chr4B 96.266 3107 95 11 1 3102 308694732 308697822 0.000000e+00 5075
10 TraesCS1D01G179600 chr6D 98.572 2802 37 3 303 3102 168253477 168256277 0.000000e+00 4950
11 TraesCS1D01G179600 chr3B 98.537 2802 37 4 303 3102 201525576 201528375 0.000000e+00 4944
12 TraesCS1D01G179600 chrUn 98.911 551 6 0 1 551 239346014 239345464 0.000000e+00 985
13 TraesCS1D01G179600 chr7D 95.205 146 7 0 223 368 204018550 204018405 6.690000e-57 231


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G179600 chr1D 254396759 254399860 3101 True 5729 5729 100.000 1 3102 1 chr1D.!!$R1 3101
1 TraesCS1D01G179600 chr3D 589278194 589281291 3097 True 5454 5454 98.421 1 3102 1 chr3D.!!$R1 3101
2 TraesCS1D01G179600 chr5D 6187190 6190291 3101 False 5435 5435 98.293 1 3102 1 chr5D.!!$F1 3101
3 TraesCS1D01G179600 chr5D 503276875 503279975 3100 True 5428 5428 98.260 1 3102 1 chr5D.!!$R2 3101
4 TraesCS1D01G179600 chr5D 432402146 432405245 3099 True 5251 5251 97.230 1 3102 1 chr5D.!!$R1 3101
5 TraesCS1D01G179600 chr5D 503216770 503219569 2799 False 4955 4955 98.608 303 3102 1 chr5D.!!$F2 2799
6 TraesCS1D01G179600 chr5A 607272649 607275750 3101 False 5241 5241 97.166 1 3102 1 chr5A.!!$F1 3101
7 TraesCS1D01G179600 chr2A 335836898 335839980 3082 False 5179 5179 96.907 1 3102 1 chr2A.!!$F1 3101
8 TraesCS1D01G179600 chr4A 309513373 309516481 3108 False 5081 5081 96.208 1 3102 1 chr4A.!!$F1 3101
9 TraesCS1D01G179600 chr4B 308694732 308697822 3090 False 5075 5075 96.266 1 3102 1 chr4B.!!$F1 3101
10 TraesCS1D01G179600 chr6D 168253477 168256277 2800 False 4950 4950 98.572 303 3102 1 chr6D.!!$F1 2799
11 TraesCS1D01G179600 chr3B 201525576 201528375 2799 False 4944 4944 98.537 303 3102 1 chr3B.!!$F1 2799
12 TraesCS1D01G179600 chrUn 239345464 239346014 550 True 985 985 98.911 1 551 1 chrUn.!!$R1 550

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
86 93 3.508402 TGTAGTTGATAGTCAAGGTCGCA 59.492 43.478 0.0 0.0 37.0 5.10 F
1513 1557 0.807275 TCTGCCGAATCGCTCATGTG 60.807 55.000 0.0 0.0 0.0 3.21 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1713 1757 2.764572 GAGAGGAGGACGGGTTATTCAA 59.235 50.0 0.0 0.0 0.00 2.69 R
2931 2980 6.829229 ATTTACGATGTACGATGATCCCTA 57.171 37.5 0.0 0.0 45.77 3.53 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
86 93 3.508402 TGTAGTTGATAGTCAAGGTCGCA 59.492 43.478 0.00 0.00 37.00 5.10
558 566 6.145048 ACCACGTTACTATTGTTTCTTTCTCG 59.855 38.462 0.00 0.00 0.00 4.04
961 1001 4.974645 TTCCTAGTTCTTCTTCCAAGCA 57.025 40.909 0.00 0.00 0.00 3.91
1345 1388 8.622948 ATCGGTTGAAGTAGATTCTTCTTTTT 57.377 30.769 6.96 0.00 42.76 1.94
1513 1557 0.807275 TCTGCCGAATCGCTCATGTG 60.807 55.000 0.00 0.00 0.00 3.21
1681 1725 5.104652 GGGGTCTTAATTACCACTGCTTAGA 60.105 44.000 8.85 0.00 37.44 2.10
1713 1757 6.855763 TGCCTCTGACCATCAAATTAAATT 57.144 33.333 0.00 0.00 0.00 1.82
1876 1920 4.695396 TGCCGTTACTCAACAGTTTTCTA 58.305 39.130 0.00 0.00 34.05 2.10
1999 2045 1.535462 CAAACCGCACTCAAAGGTAGG 59.465 52.381 0.00 0.00 37.26 3.18
2000 2046 0.036306 AACCGCACTCAAAGGTAGGG 59.964 55.000 0.00 0.00 37.26 3.53
2001 2047 1.125711 ACCGCACTCAAAGGTAGGGT 61.126 55.000 0.00 0.00 36.34 4.34
2041 2087 7.418337 AGGAACTTTTGTACCAGAAACAATT 57.582 32.000 0.00 0.00 36.75 2.32
2101 2147 4.007581 TCTCTTCTCACCATCCCCATAA 57.992 45.455 0.00 0.00 0.00 1.90
2110 2156 4.913355 TCACCATCCCCATAATGTATGAGT 59.087 41.667 0.00 0.00 38.45 3.41
2172 2218 7.808856 GGTTACGATTCTACCAGATATGTCTTC 59.191 40.741 0.00 0.00 30.42 2.87
2190 2236 6.160684 TGTCTTCTTGATTCCGTCGAAAATA 58.839 36.000 0.00 0.00 0.00 1.40
2309 2355 7.403312 TGGATCAAATTATTTCGTGGATTGT 57.597 32.000 0.00 0.00 0.00 2.71
2931 2980 3.576982 CCATTCAGCCATGGATGCTTAAT 59.423 43.478 25.40 16.37 46.18 1.40
3076 3125 5.925969 GGATCCTCGAATTGAAAGAGAGATC 59.074 44.000 3.84 11.29 37.63 2.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
558 566 9.620259 AAGATAGAAAAGGTCAATATGAAGGAC 57.380 33.333 0.00 0.00 0.00 3.85
596 628 6.575162 AAACGAATCCTTTTGTAGCTCATT 57.425 33.333 0.00 0.00 0.00 2.57
961 1001 1.776267 AACCCCTTGGGGTTATCCTGT 60.776 52.381 34.77 14.71 42.24 4.00
1513 1557 7.121168 CAGAGACCTAGGATGTAGAAGATCATC 59.879 44.444 17.98 0.00 39.49 2.92
1595 1639 9.970395 AATATGTGGAAGTATCGACGTAATTTA 57.030 29.630 0.00 0.00 38.66 1.40
1681 1725 4.773674 TGATGGTCAGAGGCAAATTGAAAT 59.226 37.500 0.00 0.00 0.00 2.17
1713 1757 2.764572 GAGAGGAGGACGGGTTATTCAA 59.235 50.000 0.00 0.00 0.00 2.69
1876 1920 4.296056 ACCTCTACGGGATAAACCTCAAT 58.704 43.478 0.00 0.00 38.98 2.57
1884 1928 6.183360 CCAATTTGACTACCTCTACGGGATAA 60.183 42.308 0.00 0.00 36.97 1.75
2041 2087 5.485353 CAGAGGGGCTATAATTGGAGATACA 59.515 44.000 0.00 0.00 0.00 2.29
2190 2236 7.490402 GTCATAAGCGCCTATACCGTAAAATAT 59.510 37.037 2.29 0.00 0.00 1.28
2309 2355 3.259876 ACCGTAGACAGGCAAGTGAAATA 59.740 43.478 0.00 0.00 0.00 1.40
2931 2980 6.829229 ATTTACGATGTACGATGATCCCTA 57.171 37.500 0.00 0.00 45.77 3.53


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.