Multiple sequence alignment - TraesCS1D01G179500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G179500 chr1D 100.000 2162 0 0 1 2162 254398620 254396459 0 3993
1 TraesCS1D01G179500 chr3B 98.428 2163 32 2 1 2162 201526514 201528675 0 3805
2 TraesCS1D01G179500 chr1A 98.428 2163 32 2 1 2162 554511738 554513899 0 3805
3 TraesCS1D01G179500 chr5D 98.382 2163 33 2 1 2162 503217708 503219869 0 3799
4 TraesCS1D01G179500 chr5D 98.058 2163 40 2 1 2162 503278736 503276575 0 3760
5 TraesCS1D01G179500 chr5D 97.966 2163 42 2 1 2162 6188430 6190591 0 3749
6 TraesCS1D01G179500 chr6D 98.289 2163 35 2 1 2162 168254416 168256577 0 3788
7 TraesCS1D01G179500 chr3D 98.151 2163 35 4 1 2162 589280052 589277894 0 3768
8 TraesCS1D01G179500 chr3A 97.920 2163 42 3 1 2162 672910517 672908357 0 3742
9 TraesCS1D01G179500 chr2B 97.455 2161 48 4 3 2162 474907946 474910100 0 3679


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G179500 chr1D 254396459 254398620 2161 True 3993 3993 100.000 1 2162 1 chr1D.!!$R1 2161
1 TraesCS1D01G179500 chr3B 201526514 201528675 2161 False 3805 3805 98.428 1 2162 1 chr3B.!!$F1 2161
2 TraesCS1D01G179500 chr1A 554511738 554513899 2161 False 3805 3805 98.428 1 2162 1 chr1A.!!$F1 2161
3 TraesCS1D01G179500 chr5D 503217708 503219869 2161 False 3799 3799 98.382 1 2162 1 chr5D.!!$F2 2161
4 TraesCS1D01G179500 chr5D 503276575 503278736 2161 True 3760 3760 98.058 1 2162 1 chr5D.!!$R1 2161
5 TraesCS1D01G179500 chr5D 6188430 6190591 2161 False 3749 3749 97.966 1 2162 1 chr5D.!!$F1 2161
6 TraesCS1D01G179500 chr6D 168254416 168256577 2161 False 3788 3788 98.289 1 2162 1 chr6D.!!$F1 2161
7 TraesCS1D01G179500 chr3D 589277894 589280052 2158 True 3768 3768 98.151 1 2162 1 chr3D.!!$R1 2161
8 TraesCS1D01G179500 chr3A 672908357 672910517 2160 True 3742 3742 97.920 1 2162 1 chr3A.!!$R1 2161
9 TraesCS1D01G179500 chr2B 474907946 474910100 2154 False 3679 3679 97.455 3 2162 1 chr2B.!!$F1 2159

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
273 274 0.807275 TCTGCCGAATCGCTCATGTG 60.807 55.0 0.0 0.0 0.0 3.21 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2090 2092 4.55333 AAACGATTAGTCCCACATGAGT 57.447 40.909 0.0 0.0 0.0 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
105 106 8.622948 ATCGGTTGAAGTAGATTCTTCTTTTT 57.377 30.769 6.96 0.00 42.76 1.94
273 274 0.807275 TCTGCCGAATCGCTCATGTG 60.807 55.000 0.00 0.00 0.00 3.21
441 442 5.104652 GGGGTCTTAATTACCACTGCTTAGA 60.105 44.000 8.85 0.00 37.44 2.10
473 474 6.855763 TGCCTCTGACCATCAAATTAAATT 57.144 33.333 0.00 0.00 0.00 1.82
636 637 4.695396 TGCCGTTACTCAACAGTTTTCTA 58.305 39.130 0.00 0.00 34.05 2.10
693 694 6.763610 GGATCAGTGATCGATTTCTAGGTTTT 59.236 38.462 23.56 0.00 39.72 2.43
761 762 1.125711 ACCGCACTCAAAGGTAGGGT 61.126 55.000 0.00 0.00 36.34 4.34
801 802 7.418337 AGGAACTTTTGTACCAGAAACAATT 57.582 32.000 0.00 0.00 36.75 2.32
861 862 4.007581 TCTCTTCTCACCATCCCCATAA 57.992 45.455 0.00 0.00 0.00 1.90
870 871 4.913355 TCACCATCCCCATAATGTATGAGT 59.087 41.667 0.00 0.00 38.45 3.41
932 933 7.808856 GGTTACGATTCTACCAGATATGTCTTC 59.191 40.741 0.00 0.00 30.42 2.87
950 951 6.160684 TGTCTTCTTGATTCCGTCGAAAATA 58.839 36.000 0.00 0.00 0.00 1.40
1069 1070 7.403312 TGGATCAAATTATTTCGTGGATTGT 57.597 32.000 0.00 0.00 0.00 2.71
1691 1693 3.576982 CCATTCAGCCATGGATGCTTAAT 59.423 43.478 25.40 16.37 46.18 1.40
1836 1838 5.925969 GGATCCTCGAATTGAAAGAGAGATC 59.074 44.000 3.84 11.29 37.63 2.75
1930 1932 9.852091 GTGATCATTTCTCTTTAGCAAAGAATT 57.148 29.630 0.00 0.00 46.13 2.17
2005 2007 6.998074 CCTAGTTGGCATTGATAACAAGGATA 59.002 38.462 1.20 0.00 39.71 2.59
2090 2092 9.527157 TTATCAGACAATCACTTATTCCCAAAA 57.473 29.630 0.00 0.00 0.00 2.44
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
273 274 7.121168 CAGAGACCTAGGATGTAGAAGATCATC 59.879 44.444 17.98 0.0 39.49 2.92
355 356 9.970395 AATATGTGGAAGTATCGACGTAATTTA 57.030 29.630 0.00 0.0 38.66 1.40
441 442 4.773674 TGATGGTCAGAGGCAAATTGAAAT 59.226 37.500 0.00 0.0 0.00 2.17
473 474 2.764572 GAGAGGAGGACGGGTTATTCAA 59.235 50.000 0.00 0.0 0.00 2.69
636 637 4.296056 ACCTCTACGGGATAAACCTCAAT 58.704 43.478 0.00 0.0 38.98 2.57
644 645 6.183360 CCAATTTGACTACCTCTACGGGATAA 60.183 42.308 0.00 0.0 36.97 1.75
725 726 7.120579 TGAGTGCGGTTTGAACTATTGATTTAT 59.879 33.333 0.00 0.0 36.20 1.40
801 802 5.485353 CAGAGGGGCTATAATTGGAGATACA 59.515 44.000 0.00 0.0 0.00 2.29
950 951 7.490402 GTCATAAGCGCCTATACCGTAAAATAT 59.510 37.037 2.29 0.0 0.00 1.28
1069 1070 3.259876 ACCGTAGACAGGCAAGTGAAATA 59.740 43.478 0.00 0.0 0.00 1.40
1691 1693 6.829229 ATTTACGATGTACGATGATCCCTA 57.171 37.500 0.00 0.0 45.77 3.53
1759 1761 9.696917 GAATATTTGCCATCTCGGAATATTTTT 57.303 29.630 0.00 0.0 36.56 1.94
1930 1932 7.235079 TGTTCAATCCTTTGATAACCAAGGTA 58.765 34.615 3.22 0.0 41.38 3.08
2090 2092 4.553330 AAACGATTAGTCCCACATGAGT 57.447 40.909 0.00 0.0 0.00 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.