Multiple sequence alignment - TraesCS1D01G179300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G179300 chr1D 100.000 2211 0 0 1 2211 254393230 254395440 0 4084
1 TraesCS1D01G179300 chr3D 98.778 2210 26 1 1 2210 589272074 589274282 0 3930
2 TraesCS1D01G179300 chr3B 98.736 2216 21 3 1 2210 101916062 101913848 0 3930
3 TraesCS1D01G179300 chr3B 98.104 2215 36 2 1 2210 201531910 201529697 0 3853
4 TraesCS1D01G179300 chrUn 98.688 2210 27 1 1 2210 216513723 216515930 0 3919
5 TraesCS1D01G179300 chrUn 98.688 2210 27 1 1 2210 286269660 286267453 0 3919
6 TraesCS1D01G179300 chr5D 98.599 2212 29 1 1 2210 503223102 503220891 0 3912
7 TraesCS1D01G179300 chr5D 98.100 2211 40 2 1 2210 6193822 6191613 0 3849
8 TraesCS1D01G179300 chr3A 98.190 2210 38 2 1 2210 672905130 672907337 0 3858
9 TraesCS1D01G179300 chr3A 97.964 2210 43 2 1 2210 594894745 594896952 0 3831


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G179300 chr1D 254393230 254395440 2210 False 4084 4084 100.000 1 2211 1 chr1D.!!$F1 2210
1 TraesCS1D01G179300 chr3D 589272074 589274282 2208 False 3930 3930 98.778 1 2210 1 chr3D.!!$F1 2209
2 TraesCS1D01G179300 chr3B 101913848 101916062 2214 True 3930 3930 98.736 1 2210 1 chr3B.!!$R1 2209
3 TraesCS1D01G179300 chr3B 201529697 201531910 2213 True 3853 3853 98.104 1 2210 1 chr3B.!!$R2 2209
4 TraesCS1D01G179300 chrUn 216513723 216515930 2207 False 3919 3919 98.688 1 2210 1 chrUn.!!$F1 2209
5 TraesCS1D01G179300 chrUn 286267453 286269660 2207 True 3919 3919 98.688 1 2210 1 chrUn.!!$R1 2209
6 TraesCS1D01G179300 chr5D 503220891 503223102 2211 True 3912 3912 98.599 1 2210 1 chr5D.!!$R2 2209
7 TraesCS1D01G179300 chr5D 6191613 6193822 2209 True 3849 3849 98.100 1 2210 1 chr5D.!!$R1 2209
8 TraesCS1D01G179300 chr3A 672905130 672907337 2207 False 3858 3858 98.190 1 2210 1 chr3A.!!$F2 2209
9 TraesCS1D01G179300 chr3A 594894745 594896952 2207 False 3831 3831 97.964 1 2210 1 chr3A.!!$F1 2209

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
462 464 3.628008 TCAATAGGACTCCTTACGAGCA 58.372 45.455 1.94 0.0 43.01 4.26 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1299 1302 0.96692 GAGGACTCAAACCTCCACGA 59.033 55.0 0.0 0.0 45.64 4.35 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
54 55 8.783660 TCTTCTTCTGGAAATCCTAGCTATTA 57.216 34.615 0.00 0.00 36.82 0.98
122 123 5.809719 TGAAACGTATGCTTGCATATTCA 57.190 34.783 16.86 17.76 0.00 2.57
308 309 7.227049 TCGAGATTATGCAGGATTATACACA 57.773 36.000 0.00 0.00 0.00 3.72
462 464 3.628008 TCAATAGGACTCCTTACGAGCA 58.372 45.455 1.94 0.00 43.01 4.26
788 790 7.148623 GCGCTAGGGTTATGAACTTATAATCAC 60.149 40.741 8.77 0.00 0.00 3.06
840 843 3.843619 TCATTCCATACAGAACCAGACCA 59.156 43.478 0.00 0.00 0.00 4.02
1267 1270 3.772387 TGCCTTGATGGTGAAATGGTAA 58.228 40.909 0.00 0.00 38.35 2.85
1299 1302 4.573900 ACTCAAAATCTCGTGCTGAAGAT 58.426 39.130 0.00 0.00 0.00 2.40
1310 1313 1.347707 TGCTGAAGATCGTGGAGGTTT 59.652 47.619 0.00 0.00 0.00 3.27
1653 1658 4.957296 ACACGACAGGAAAAAGTGACTAT 58.043 39.130 0.69 0.00 36.71 2.12
1922 1937 7.434492 AGAGTCTCGTCTTTTGTCATTCTTTA 58.566 34.615 0.00 0.00 0.00 1.85
2206 2223 5.344884 CGAAAGAGAATCCAGTACCTCTTC 58.655 45.833 9.38 0.23 43.00 2.87
2210 2227 3.949113 GAGAATCCAGTACCTCTTCGTCT 59.051 47.826 0.00 0.00 0.00 4.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
54 55 5.541484 GGAGATTCCCCAAAATCATGCTAAT 59.459 40.000 0.00 0.00 37.98 1.73
122 123 4.228210 ACATATCCGATTTGCCCTATGGAT 59.772 41.667 0.00 0.00 39.44 3.41
172 173 7.712204 ATCATGCTTGCATATCCATCATTTA 57.288 32.000 7.84 0.00 0.00 1.40
788 790 2.224314 TCTGATGATCGAGTCGATTCCG 59.776 50.000 27.65 18.04 47.00 4.30
829 832 2.040813 AGAATGTGCATGGTCTGGTTCT 59.959 45.455 0.00 0.00 0.00 3.01
840 843 6.718454 CCCCTTCTCATAATAAGAATGTGCAT 59.282 38.462 0.00 0.00 32.56 3.96
1267 1270 2.731976 GAGATTTTGAGTCTCGCGTGTT 59.268 45.455 5.77 0.00 33.48 3.32
1299 1302 0.966920 GAGGACTCAAACCTCCACGA 59.033 55.000 0.00 0.00 45.64 4.35
1483 1486 5.428783 TCTCCTTCGAGGGATTTTTAGGATT 59.571 40.000 17.64 0.00 35.59 3.01
1633 1638 5.209818 TCATAGTCACTTTTTCCTGTCGT 57.790 39.130 0.00 0.00 0.00 4.34
1653 1658 3.133003 TCGCAAACAAAAAGGGGAATTCA 59.867 39.130 7.93 0.00 0.00 2.57
1922 1937 6.310149 AGGAATCATTGAGTGAAAAAGGAGT 58.690 36.000 0.00 0.00 40.97 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.